\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401615936:

Variant ID: vg0401615936 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1615936
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.26, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATACGCAATGAAATTTTGAATGGTTTATGTATACGTACATCGAGCTCTCGTGTGGTATATATTTGGTTTGATAGCCAGTGGGCATACTCACGTACGTAGT[A/G]
GCCGCATAAGTTTGTTCCCTGTTCCTGCTTTGCACACTACATGAGAAACGATGAGAGATTTAATATACTCTTTATATTAACTGTAACTAGAGATTCAATT

Reverse complement sequence

AATTGAATCTCTAGTTACAGTTAATATAAAGAGTATATTAAATCTCTCATCGTTTCTCATGTAGTGTGCAAAGCAGGAACAGGGAACAAACTTATGCGGC[T/C]
ACTACGTACGTGAGTATGCCCACTGGCTATCAAACCAAATATATACCACACGAGAGCTCGATGTACGTATACATAAACCATTCAAAATTTCATTGCGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.40% 15.30% 0.15% 65.13% NA
All Indica  2759 11.70% 15.10% 0.14% 73.00% NA
All Japonica  1512 36.40% 16.30% 0.00% 47.29% NA
Aus  269 9.30% 3.70% 0.74% 86.25% NA
Indica I  595 27.60% 3.20% 0.34% 68.91% NA
Indica II  465 6.90% 37.80% 0.00% 55.27% NA
Indica III  913 2.70% 6.60% 0.00% 90.69% NA
Indica Intermediate  786 13.10% 20.60% 0.25% 66.03% NA
Temperate Japonica  767 62.60% 19.00% 0.00% 18.38% NA
Tropical Japonica  504 5.40% 13.90% 0.00% 80.75% NA
Japonica Intermediate  241 17.80% 12.90% 0.00% 69.29% NA
VI/Aromatic  96 1.00% 33.30% 0.00% 65.62% NA
Intermediate  90 17.80% 21.10% 1.11% 60.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401615936 A -> DEL N N silent_mutation Average:7.886; most accessible tissue: Callus, score: 28.998 N N N N
vg0401615936 A -> G LOC_Os04g03650.1 downstream_gene_variant ; 4379.0bp to feature; MODIFIER silent_mutation Average:7.886; most accessible tissue: Callus, score: 28.998 N N N N
vg0401615936 A -> G LOC_Os04g03660.1 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:7.886; most accessible tissue: Callus, score: 28.998 N N N N
vg0401615936 A -> G LOC_Os04g03660-LOC_Os04g03680 intergenic_region ; MODIFIER silent_mutation Average:7.886; most accessible tissue: Callus, score: 28.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401615936 NA 1.47E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401615936 NA 4.48E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 3.91E-06 mr1219 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 8.60E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 9.65E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 1.21E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 5.36E-09 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 4.20E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 6.18E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 1.55E-06 mr1344_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 4.09E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 6.95E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 NA 2.59E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401615936 7.71E-07 7.71E-07 mr1950_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251