Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401607740:

Variant ID: vg0401607740 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1607740
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTCTAGAGGTGCCAAATCCCTCGCCTCAGATGCCTTGTGAGGCTTGCGAGGTTGTTTCGATTGAACACAAGTATGGCACTTGAAACATTTGACCAAAGT[G/A]
AATTTTGGAATTAAACTCATGGTTAGCCAAGCGCGTCATACAACCGAAATTCACATGACAGAGTAGCGAATGCCACACATTGGACTCATCATTCTCGCTA

Reverse complement sequence

TAGCGAGAATGATGAGTCCAATGTGTGGCATTCGCTACTCTGTCATGTGAATTTCGGTTGTATGACGCGCTTGGCTAACCATGAGTTTAATTCCAAAATT[C/T]
ACTTTGGTCAAATGTTTCAAGTGCCATACTTGTGTTCAATCGAAACAACCTCGCAAGCCTCACAAGGCATCTGAGGCGAGGGATTTGGCACCTCTAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.00%	0.50%	34.53%	18.03%	NA
All Indica	2759	50.10%	0.50%	44.47%	4.86%	NA
All Japonica	1512	45.20%	0.20%	10.58%	43.98%	NA
Aus	269	35.70%	1.10%	60.22%	2.97%	NA
Indica I	595	61.20%	1.30%	31.76%	5.71%	NA
Indica II	465	40.40%	0.00%	51.83%	7.74%	NA
Indica III	913	42.50%	0.00%	54.65%	2.85%	NA
Indica Intermediate	786	56.40%	0.90%	37.91%	4.83%	NA
Temperate Japonica	767	65.20%	0.00%	4.04%	30.77%	NA
Tropical Japonica	504	16.30%	0.20%	18.85%	64.68%	NA
Japonica Intermediate	241	42.30%	0.80%	14.11%	42.74%	NA
VI/Aromatic	96	9.40%	0.00%	56.25%	34.38%	NA
Intermediate	90	53.30%	1.10%	32.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401607740	G -> DEL	N	N	silent_mutation	Average:9.89; most accessible tissue: Callus, score: 21.651	N	N	N	N
vg0401607740	G -> A	LOC_Os04g03630.1	upstream_gene_variant ; 4177.0bp to feature; MODIFIER	silent_mutation	Average:9.89; most accessible tissue: Callus, score: 21.651	N	N	N	N
vg0401607740	G -> A	LOC_Os04g03650.1	upstream_gene_variant ; 3173.0bp to feature; MODIFIER	silent_mutation	Average:9.89; most accessible tissue: Callus, score: 21.651	N	N	N	N
vg0401607740	G -> A	LOC_Os04g03640.1	intron_variant ; MODIFIER	silent_mutation	Average:9.89; most accessible tissue: Callus, score: 21.651	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401607740	NA	3.48E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	1.08E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	5.52E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	3.01E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	6.24E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	1.05E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	5.08E-09	mr1606	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	7.43E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	2.77E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	1.13E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	2.45E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	2.91E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	4.37E-09	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	5.55E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	3.34E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	1.31E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740	NA	1.51E-10	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251