\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401607740:

Variant ID: vg0401607740 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1607740
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCTAGAGGTGCCAAATCCCTCGCCTCAGATGCCTTGTGAGGCTTGCGAGGTTGTTTCGATTGAACACAAGTATGGCACTTGAAACATTTGACCAAAGT[G/A]
AATTTTGGAATTAAACTCATGGTTAGCCAAGCGCGTCATACAACCGAAATTCACATGACAGAGTAGCGAATGCCACACATTGGACTCATCATTCTCGCTA

Reverse complement sequence

TAGCGAGAATGATGAGTCCAATGTGTGGCATTCGCTACTCTGTCATGTGAATTTCGGTTGTATGACGCGCTTGGCTAACCATGAGTTTAATTCCAAAATT[C/T]
ACTTTGGTCAAATGTTTCAAGTGCCATACTTGTGTTCAATCGAAACAACCTCGCAAGCCTCACAAGGCATCTGAGGCGAGGGATTTGGCACCTCTAGAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 0.50% 34.53% 18.03% NA
All Indica  2759 50.10% 0.50% 44.47% 4.86% NA
All Japonica  1512 45.20% 0.20% 10.58% 43.98% NA
Aus  269 35.70% 1.10% 60.22% 2.97% NA
Indica I  595 61.20% 1.30% 31.76% 5.71% NA
Indica II  465 40.40% 0.00% 51.83% 7.74% NA
Indica III  913 42.50% 0.00% 54.65% 2.85% NA
Indica Intermediate  786 56.40% 0.90% 37.91% 4.83% NA
Temperate Japonica  767 65.20% 0.00% 4.04% 30.77% NA
Tropical Japonica  504 16.30% 0.20% 18.85% 64.68% NA
Japonica Intermediate  241 42.30% 0.80% 14.11% 42.74% NA
VI/Aromatic  96 9.40% 0.00% 56.25% 34.38% NA
Intermediate  90 53.30% 1.10% 32.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401607740 G -> DEL N N silent_mutation Average:9.89; most accessible tissue: Callus, score: 21.651 N N N N
vg0401607740 G -> A LOC_Os04g03630.1 upstream_gene_variant ; 4177.0bp to feature; MODIFIER silent_mutation Average:9.89; most accessible tissue: Callus, score: 21.651 N N N N
vg0401607740 G -> A LOC_Os04g03650.1 upstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:9.89; most accessible tissue: Callus, score: 21.651 N N N N
vg0401607740 G -> A LOC_Os04g03640.1 intron_variant ; MODIFIER silent_mutation Average:9.89; most accessible tissue: Callus, score: 21.651 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401607740 NA 3.48E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 1.08E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 5.52E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 3.01E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 6.24E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 1.05E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 5.08E-09 mr1606 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 7.43E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 2.77E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 1.13E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 2.45E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 2.91E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 4.37E-09 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 5.55E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 3.34E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 1.31E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401607740 NA 1.51E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251