\
| Variant ID: vg0401505122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1505122 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.04, others allele: 0.00, population size: 45. )
TCCTCATTTCTTCTCCTCCCCGATTCCCAAACCCTAGCCGCCGCAACAGTACTCCTCTCGGCGATTTTCACTTCCAACCGTGGAAATTTGATTCCTCTCC[A/G]
TGGAATCAACCACATTGGTGGCTAGGAGGTTCATCCCGCGATCGATTTGCGATTTCCTCTCTCAAGGTAGCACTTCTGATCTTCTCTTTTGGTTCATCAT
ATGATGAACCAAAAGAGAAGATCAGAAGTGCTACCTTGAGAGAGGAAATCGCAAATCGATCGCGGGATGAACCTCCTAGCCACCAATGTGGTTGATTCCA[T/C]
GGAGAGGAATCAAATTTCCACGGTTGGAAGTGAAAATCGCCGAGAGGAGTACTGTTGCGGCGGCTAGGGTTTGGGAATCGGGGAGGAGAAGAAATGAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.30% | 30.70% | 20.57% | 15.43% | NA |
| All Indica | 2759 | 24.70% | 44.80% | 25.37% | 5.07% | NA |
| All Japonica | 1512 | 52.10% | 7.60% | 11.57% | 28.70% | NA |
| Aus | 269 | 20.10% | 25.70% | 22.30% | 31.97% | NA |
| Indica I | 595 | 53.30% | 23.70% | 17.98% | 5.04% | NA |
| Indica II | 465 | 25.60% | 34.40% | 33.33% | 6.67% | NA |
| Indica III | 913 | 5.80% | 66.80% | 24.32% | 3.07% | NA |
| Indica Intermediate | 786 | 24.60% | 41.50% | 27.48% | 6.49% | NA |
| Temperate Japonica | 767 | 75.10% | 6.00% | 4.17% | 14.73% | NA |
| Tropical Japonica | 504 | 19.40% | 7.90% | 24.60% | 48.02% | NA |
| Japonica Intermediate | 241 | 47.30% | 12.00% | 7.88% | 32.78% | NA |
| VI/Aromatic | 96 | 12.50% | 12.50% | 15.62% | 59.38% | NA |
| Intermediate | 90 | 40.00% | 22.20% | 24.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401505122 | A -> DEL | N | N | silent_mutation | Average:7.921; most accessible tissue: Callus, score: 13.325 | N | N | N | N |
| vg0401505122 | A -> G | LOC_Os04g03480.1 | upstream_gene_variant ; 347.0bp to feature; MODIFIER | silent_mutation | Average:7.921; most accessible tissue: Callus, score: 13.325 | N | N | N | N |
| vg0401505122 | A -> G | LOC_Os04g03470.1 | downstream_gene_variant ; 936.0bp to feature; MODIFIER | silent_mutation | Average:7.921; most accessible tissue: Callus, score: 13.325 | N | N | N | N |
| vg0401505122 | A -> G | LOC_Os04g03490.1 | downstream_gene_variant ; 2941.0bp to feature; MODIFIER | silent_mutation | Average:7.921; most accessible tissue: Callus, score: 13.325 | N | N | N | N |
| vg0401505122 | A -> G | LOC_Os04g03470-LOC_Os04g03480 | intergenic_region ; MODIFIER | silent_mutation | Average:7.921; most accessible tissue: Callus, score: 13.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401505122 | NA | 2.76E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 1.06E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 2.62E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 5.75E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | 4.43E-06 | NA | mr1422_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | 4.08E-06 | 4.08E-06 | mr1478_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | 4.91E-06 | 4.91E-06 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 5.63E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 8.41E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 9.76E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401505122 | NA | 5.69E-09 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |