\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401505122:

Variant ID: vg0401505122 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1505122
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.04, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCATTTCTTCTCCTCCCCGATTCCCAAACCCTAGCCGCCGCAACAGTACTCCTCTCGGCGATTTTCACTTCCAACCGTGGAAATTTGATTCCTCTCC[A/G]
TGGAATCAACCACATTGGTGGCTAGGAGGTTCATCCCGCGATCGATTTGCGATTTCCTCTCTCAAGGTAGCACTTCTGATCTTCTCTTTTGGTTCATCAT

Reverse complement sequence

ATGATGAACCAAAAGAGAAGATCAGAAGTGCTACCTTGAGAGAGGAAATCGCAAATCGATCGCGGGATGAACCTCCTAGCCACCAATGTGGTTGATTCCA[T/C]
GGAGAGGAATCAAATTTCCACGGTTGGAAGTGAAAATCGCCGAGAGGAGTACTGTTGCGGCGGCTAGGGTTTGGGAATCGGGGAGGAGAAGAAATGAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 30.70% 20.57% 15.43% NA
All Indica  2759 24.70% 44.80% 25.37% 5.07% NA
All Japonica  1512 52.10% 7.60% 11.57% 28.70% NA
Aus  269 20.10% 25.70% 22.30% 31.97% NA
Indica I  595 53.30% 23.70% 17.98% 5.04% NA
Indica II  465 25.60% 34.40% 33.33% 6.67% NA
Indica III  913 5.80% 66.80% 24.32% 3.07% NA
Indica Intermediate  786 24.60% 41.50% 27.48% 6.49% NA
Temperate Japonica  767 75.10% 6.00% 4.17% 14.73% NA
Tropical Japonica  504 19.40% 7.90% 24.60% 48.02% NA
Japonica Intermediate  241 47.30% 12.00% 7.88% 32.78% NA
VI/Aromatic  96 12.50% 12.50% 15.62% 59.38% NA
Intermediate  90 40.00% 22.20% 24.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401505122 A -> DEL N N silent_mutation Average:7.921; most accessible tissue: Callus, score: 13.325 N N N N
vg0401505122 A -> G LOC_Os04g03480.1 upstream_gene_variant ; 347.0bp to feature; MODIFIER silent_mutation Average:7.921; most accessible tissue: Callus, score: 13.325 N N N N
vg0401505122 A -> G LOC_Os04g03470.1 downstream_gene_variant ; 936.0bp to feature; MODIFIER silent_mutation Average:7.921; most accessible tissue: Callus, score: 13.325 N N N N
vg0401505122 A -> G LOC_Os04g03490.1 downstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:7.921; most accessible tissue: Callus, score: 13.325 N N N N
vg0401505122 A -> G LOC_Os04g03470-LOC_Os04g03480 intergenic_region ; MODIFIER silent_mutation Average:7.921; most accessible tissue: Callus, score: 13.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401505122 NA 2.76E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 1.06E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 2.62E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 5.75E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 4.43E-06 NA mr1422_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 4.08E-06 4.08E-06 mr1478_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 4.91E-06 4.91E-06 mr1529_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 5.63E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 8.41E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 9.76E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401505122 NA 5.69E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251