\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401488518:

Variant ID: vg0401488518 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1488518
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTGACAACAATGTCATCGACGTAGGCCTCGACATTGATCCCAAGCTGGTCGTTAAGTGCCCCTTGGACCGTGCGCTGGAAGGTGTTTCCTGCAGTTAT[C/T]
AGTCCAAATGGCATCTTAACGTAGCAGAATACACCGAATGGCGTGATGAATGCTGTCTTCTCCTCGTCCTCTTTCGTCACGCTGAACTGGTGGTACCCAG

Reverse complement sequence

CTGGGTACCACCAGTTCAGCGTGACGAAAGAGGACGAGGAGAAGACAGCATTCATCACGCCATTCGGTGTATTCTGCTACGTTAAGATGCCATTTGGACT[G/A]
ATAACTGCAGGAAACACCTTCCAGCGCACGGTCCAAGGGGCACTTAACGACCAGCTTGGGATCAATGTCGAGGCCTACGTCGATGACATTGTTGTCAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 3.10% 0.78% 3.70% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 80.40% 6.30% 1.98% 11.31% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 79.10% 8.90% 1.56% 10.43% NA
Tropical Japonica  504 84.90% 0.20% 2.38% 12.50% NA
Japonica Intermediate  241 75.10% 10.80% 2.49% 11.62% NA
VI/Aromatic  96 40.60% 50.00% 5.21% 4.17% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401488518 C -> DEL LOC_Os04g03450.1 N frameshift_variant Average:19.336; most accessible tissue: Callus, score: 35.342 N N N N
vg0401488518 C -> T LOC_Os04g03450.1 synonymous_variant ; p.Leu850Leu; LOW synonymous_codon Average:19.336; most accessible tissue: Callus, score: 35.342 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401488518 NA 7.37E-24 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401488518 NA 5.14E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401488518 NA 6.09E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 8.74E-07 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 9.60E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 7.66E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 1.12E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 1.46E-06 1.43E-08 mr1201 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 5.38E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 8.11E-07 mr1219 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 4.70E-06 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 4.23E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 1.39E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 6.69E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 5.00E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 1.09E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 8.09E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 4.75E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 9.52E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 5.39E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 4.09E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 1.33E-06 2.78E-08 mr1274_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 2.69E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401488518 NA 6.79E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251