\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401443541:

Variant ID: vg0401443541 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1443541
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGTCCAGTACGTCCATCGGAATCCGATTCGACCGCGGCCACAGACCAACCCGACAGCAAATAATCCGGCCTGTTGTTTCCAATAAATACACAGTGCTA[G/A]
CTATGGGCTATGGCAAAACAAAATCGCAGCCTCTGCTCTGGAATTCTCAATAATCCGATTACAATAATAATAACTCGATCGGTGCAGTACTGCAGCCTTC

Reverse complement sequence

GAAGGCTGCAGTACTGCACCGATCGAGTTATTATTATTGTAATCGGATTATTGAGAATTCCAGAGCAGAGGCTGCGATTTTGTTTTGCCATAGCCCATAG[C/T]
TAGCACTGTGTATTTATTGGAAACAACAGGCCGGATTATTTGCTGTCGGGTTGGTCTGTGGCCGCGGTCGAATCGGATTCCGATGGACGTACTGGACTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 10.20% 0.30% 0.00% NA
All Indica  2759 97.90% 1.90% 0.22% 0.00% NA
All Japonica  1512 72.00% 27.50% 0.46% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.10% 0.76% 0.00% NA
Temperate Japonica  767 96.10% 3.70% 0.26% 0.00% NA
Tropical Japonica  504 44.80% 54.80% 0.40% 0.00% NA
Japonica Intermediate  241 52.30% 46.50% 1.24% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401443541 G -> A LOC_Os04g03360.1 upstream_gene_variant ; 552.0bp to feature; MODIFIER silent_mutation Average:65.321; most accessible tissue: Callus, score: 90.888 N N N N
vg0401443541 G -> A LOC_Os04g03350.1 downstream_gene_variant ; 1536.0bp to feature; MODIFIER silent_mutation Average:65.321; most accessible tissue: Callus, score: 90.888 N N N N
vg0401443541 G -> A LOC_Os04g03370.1 downstream_gene_variant ; 3197.0bp to feature; MODIFIER silent_mutation Average:65.321; most accessible tissue: Callus, score: 90.888 N N N N
vg0401443541 G -> A LOC_Os04g03350-LOC_Os04g03360 intergenic_region ; MODIFIER silent_mutation Average:65.321; most accessible tissue: Callus, score: 90.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401443541 4.59E-06 NA mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 8.35E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 6.60E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 2.88E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 6.46E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 4.66E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 1.87E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 2.02E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 1.21E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 3.33E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 4.33E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 5.72E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541 NA 4.83E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251