Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401443541:

Variant ID: vg0401443541 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1443541
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGTCCAGTACGTCCATCGGAATCCGATTCGACCGCGGCCACAGACCAACCCGACAGCAAATAATCCGGCCTGTTGTTTCCAATAAATACACAGTGCTA[G/A]
CTATGGGCTATGGCAAAACAAAATCGCAGCCTCTGCTCTGGAATTCTCAATAATCCGATTACAATAATAATAACTCGATCGGTGCAGTACTGCAGCCTTC

Reverse complement sequence

GAAGGCTGCAGTACTGCACCGATCGAGTTATTATTATTGTAATCGGATTATTGAGAATTCCAGAGCAGAGGCTGCGATTTTGTTTTGCCATAGCCCATAG[C/T]
TAGCACTGTGTATTTATTGGAAACAACAGGCCGGATTATTTGCTGTCGGGTTGGTCTGTGGCCGCGGTCGAATCGGATTCCGATGGACGTACTGGACTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.20%	0.30%	0.00%	NA
All Indica	2759	97.90%	1.90%	0.22%	0.00%	NA
All Japonica	1512	72.00%	27.50%	0.46%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.10%	0.76%	0.00%	NA
Temperate Japonica	767	96.10%	3.70%	0.26%	0.00%	NA
Tropical Japonica	504	44.80%	54.80%	0.40%	0.00%	NA
Japonica Intermediate	241	52.30%	46.50%	1.24%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401443541	G -> A	LOC_Os04g03360.1	upstream_gene_variant ; 552.0bp to feature; MODIFIER	silent_mutation	Average:65.321; most accessible tissue: Callus, score: 90.888	N	N	N	N
vg0401443541	G -> A	LOC_Os04g03350.1	downstream_gene_variant ; 1536.0bp to feature; MODIFIER	silent_mutation	Average:65.321; most accessible tissue: Callus, score: 90.888	N	N	N	N
vg0401443541	G -> A	LOC_Os04g03370.1	downstream_gene_variant ; 3197.0bp to feature; MODIFIER	silent_mutation	Average:65.321; most accessible tissue: Callus, score: 90.888	N	N	N	N
vg0401443541	G -> A	LOC_Os04g03350-LOC_Os04g03360	intergenic_region ; MODIFIER	silent_mutation	Average:65.321; most accessible tissue: Callus, score: 90.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401443541	4.59E-06	NA	mr1174_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	8.35E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	6.60E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	2.88E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	6.46E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	4.66E-09	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	1.87E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	2.02E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	1.21E-09	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	3.33E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	4.33E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	5.72E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401443541	NA	4.83E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251