Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401363131:

Variant ID: vg0401363131 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1363131
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATGTAGTTCAGAATAATTATAATTGATATTGTGATTCCCAAAGAAAAAATCATATGCAATAGCCAGTCCACAAGCGTGTGGTAGGTAGGACACAAAC[C/A]
CGGGACATACTTCGGTGTTTTTCATTTTGACTACCCTTTCTTATCTGATAAATTTGAAAAATATTAGGCATCTATATGACTTCAAAACATAATGTCAGCT

Reverse complement sequence

AGCTGACATTATGTTTTGAAGTCATATAGATGCCTAATATTTTTCAAATTTATCAGATAAGAAAGGGTAGTCAAAATGAAAAACACCGAAGTATGTCCCG[G/T]
GTTTGTGTCCTACCTACCACACGCTTGTGGACTGGCTATTGCATATGATTTTTTCTTTGGGAATCACAATATCAATTATAATTATTCTGAACTACATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.10%	25.70%	0.17%	0.00%	NA
All Indica	2759	59.30%	40.40%	0.25%	0.00%	NA
All Japonica	1512	96.10%	3.80%	0.07%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	77.50%	21.50%	1.01%	0.00%	NA
Indica II	465	47.10%	52.90%	0.00%	0.00%	NA
Indica III	913	65.70%	34.30%	0.00%	0.00%	NA
Indica Intermediate	786	45.30%	54.60%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	89.70%	10.10%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401363131	C -> A	LOC_Os04g03210.1	upstream_gene_variant ; 908.0bp to feature; MODIFIER	silent_mutation	Average:34.559; most accessible tissue: Callus, score: 61.09	N	N	N	N
vg0401363131	C -> A	LOC_Os04g03220.1	downstream_gene_variant ; 3009.0bp to feature; MODIFIER	silent_mutation	Average:34.559; most accessible tissue: Callus, score: 61.09	N	N	N	N
vg0401363131	C -> A	LOC_Os04g03210-LOC_Os04g03220	intergenic_region ; MODIFIER	silent_mutation	Average:34.559; most accessible tissue: Callus, score: 61.09	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401363131	NA	3.87E-07	mr1036	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	3.39E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	1.24E-07	mr1343	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	8.02E-06	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	8.99E-06	mr1592	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	2.23E-07	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	5.13E-06	5.13E-06	mr1770	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	1.68E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	2.22E-09	mr1861	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401363131	NA	6.09E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251