\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401358404:

Variant ID: vg0401358404 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1358404
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTATGGTACAACTACTCTTATATATTTCCTTCTCTCTCTTTTTTTTTCAAAAAGAAAATTGCACCATTGGTACAAGAATTTGGGAGCTGTGTTCATTTAA[C/T]
TATTACAAAACTTTCAGCCCATGGGTATAATAACTCGGTAAGTATTTACATAATTACATTTGAGTACAATAACTTAAAAATTGACCGTGCCACTGAGACT

Reverse complement sequence

AGTCTCAGTGGCACGGTCAATTTTTAAGTTATTGTACTCAAATGTAATTATGTAAATACTTACCGAGTTATTATACCCATGGGCTGAAAGTTTTGTAATA[G/A]
TTAAATGAACACAGCTCCCAAATTCTTGTACCAATGGTGCAATTTTCTTTTTGAAAAAAAAAGAGAGAGAAGGAAATATATAAGAGTAGTTGTACCATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.70% 0.08% 0.00% NA
All Indica  2759 60.90% 39.00% 0.11% 0.00% NA
All Japonica  1512 95.60% 4.40% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 29.60% 70.40% 0.00% 0.00% NA
Indica II  465 76.60% 23.40% 0.00% 0.00% NA
Indica III  913 74.80% 25.00% 0.22% 0.00% NA
Indica Intermediate  786 59.00% 40.80% 0.13% 0.00% NA
Temperate Japonica  767 99.00% 0.90% 0.13% 0.00% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401358404 C -> T LOC_Os04g03200.1 upstream_gene_variant ; 1291.0bp to feature; MODIFIER silent_mutation Average:52.01; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0401358404 C -> T LOC_Os04g03210.1 downstream_gene_variant ; 259.0bp to feature; MODIFIER silent_mutation Average:52.01; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0401358404 C -> T LOC_Os04g03200-LOC_Os04g03210 intergenic_region ; MODIFIER silent_mutation Average:52.01; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401358404 NA 1.78E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 4.57E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.41E-06 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 2.23E-07 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 3.43E-11 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.28E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 2.11E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 3.93E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.27E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 2.87E-09 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 4.41E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.91E-07 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 3.67E-08 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.01E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.93E-07 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 1.74E-06 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 3.80E-06 NA mr1442_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 4.68E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 4.73E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 7.03E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 8.65E-13 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 6.44E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 3.81E-07 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 5.33E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401358404 NA 3.27E-08 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251