\
| Variant ID: vg0401358404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1358404 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 94. )
GTATGGTACAACTACTCTTATATATTTCCTTCTCTCTCTTTTTTTTTCAAAAAGAAAATTGCACCATTGGTACAAGAATTTGGGAGCTGTGTTCATTTAA[C/T]
TATTACAAAACTTTCAGCCCATGGGTATAATAACTCGGTAAGTATTTACATAATTACATTTGAGTACAATAACTTAAAAATTGACCGTGCCACTGAGACT
AGTCTCAGTGGCACGGTCAATTTTTAAGTTATTGTACTCAAATGTAATTATGTAAATACTTACCGAGTTATTATACCCATGGGCTGAAAGTTTTGTAATA[G/A]
TTAAATGAACACAGCTCCCAAATTCTTGTACCAATGGTGCAATTTTCTTTTTGAAAAAAAAAGAGAGAGAAGGAAATATATAAGAGTAGTTGTACCATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 24.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 60.90% | 39.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 95.60% | 4.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.80% | 25.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 59.00% | 40.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401358404 | C -> T | LOC_Os04g03200.1 | upstream_gene_variant ; 1291.0bp to feature; MODIFIER | silent_mutation | Average:52.01; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| vg0401358404 | C -> T | LOC_Os04g03210.1 | downstream_gene_variant ; 259.0bp to feature; MODIFIER | silent_mutation | Average:52.01; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| vg0401358404 | C -> T | LOC_Os04g03200-LOC_Os04g03210 | intergenic_region ; MODIFIER | silent_mutation | Average:52.01; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401358404 | NA | 1.78E-07 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 4.57E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.41E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 2.23E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 3.43E-11 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.28E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 2.11E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 3.93E-06 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.27E-08 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 2.87E-09 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 4.41E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.91E-07 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 3.67E-08 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.01E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.93E-07 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 1.74E-06 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | 3.80E-06 | NA | mr1442_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 4.68E-06 | mr1442_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 4.73E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 7.03E-06 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 8.65E-13 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 6.44E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 3.81E-07 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 5.33E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401358404 | NA | 3.27E-08 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |