\
| Variant ID: vg0401349008 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1349008 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.10, others allele: 0.00, population size: 49. )
CGTATCTTAGAGACAGATGAGAGAAGAACTAGGAATCGAGTTATCCGTTTCTGCAAGGTCCAATGGAGTAATCACTCGGAAGAAGAAGCTACCTGGGAGC[A/G]
AGAAGATGAATTAAAGTCAGCTCATCCGCATCTTTTCGCCAGCTCTTCCGAATCTCGAGGACGAGATTCTGTTTAATGGGGATAGGTTTGTCACACCCTA
TAGGGTGTGACAAACCTATCCCCATTAAACAGAATCTCGTCCTCGAGATTCGGAAGAGCTGGCGAAAAGATGCGGATGAGCTGACTTTAATTCATCTTCT[T/C]
GCTCCCAGGTAGCTTCTTCTTCCGAGTGATTACTCCATTGGACCTTGCAGAAACGGATAACTCGATTCCTAGTTCTTCTCTCATCTGTCTCTAAGATACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 13.10% | 1.50% | 5.25% | 80.22% | NA |
| All Indica | 2759 | 2.80% | 1.60% | 3.81% | 91.88% | NA |
| All Japonica | 1512 | 34.70% | 1.20% | 7.41% | 56.75% | NA |
| Aus | 269 | 0.70% | 0.70% | 4.09% | 94.42% | NA |
| Indica I | 595 | 1.20% | 0.00% | 1.01% | 97.82% | NA |
| Indica II | 465 | 7.70% | 0.90% | 5.59% | 85.81% | NA |
| Indica III | 913 | 1.20% | 3.00% | 4.38% | 91.46% | NA |
| Indica Intermediate | 786 | 2.80% | 1.50% | 4.20% | 91.48% | NA |
| Temperate Japonica | 767 | 49.20% | 1.20% | 1.96% | 47.72% | NA |
| Tropical Japonica | 504 | 17.10% | 0.80% | 13.89% | 68.25% | NA |
| Japonica Intermediate | 241 | 25.30% | 2.10% | 11.20% | 61.41% | NA |
| VI/Aromatic | 96 | 3.10% | 3.10% | 15.62% | 78.12% | NA |
| Intermediate | 90 | 13.30% | 4.40% | 5.56% | 76.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401349008 | A -> DEL | LOC_Os04g03190.1 | N | frameshift_variant | Average:10.725; most accessible tissue: Callus, score: 23.517 | N | N | N | N |
| vg0401349008 | A -> G | LOC_Os04g03190.1 | missense_variant ; p.Gln1293Arg; MODERATE | nonsynonymous_codon ; Q1293R | Average:10.725; most accessible tissue: Callus, score: 23.517 | benign |
-0.909 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401349008 | 7.39E-08 | NA | mr1016 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.81E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 9.38E-07 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 7.93E-06 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 4.78E-08 | NA | mr1055 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 5.29E-08 | NA | mr1132 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.65E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.41E-06 | NA | mr1390 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 5.60E-07 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.89E-06 | NA | mr1490 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 9.05E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 8.16E-06 | NA | mr1805 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.09E-07 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 2.35E-08 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 3.29E-08 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 7.99E-06 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.34E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.71E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401349008 | 1.75E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |