Search for Variation information by Variation ID:
Detailed information for vg0401346827:
| Variant ID: vg0401346827 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1346827 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 46. )
Flanking Sequence (100 bp) in Reference Genome:
ATTGACGACATTCTTATCTACTCCCGAACCAGAGAAGAGCATGAAGAGCACCTTCGTCTTGCATTGGAGAAGTTACGAGAACATCAGCTGTATGCCAAGT[A/T]
TAGCAAATGTGAATTTTGGTTGTCTGAAGTAAAGTTCCTTGGACACGTCATCTCAGCCGGAGGAGTTGCCGTTGATCCTAGTAATGTGGAATCCGTAACT
Reverse complement sequence
AGTTACGGATTCCACATTACTAGGATCAACGGCAACTCCTCCGGCTGAGATGACGTGTCCAAGGAACTTTACTTCAGACAACCAAAATTCACATTTGCTA[T/A]
ACTTGGCATACAGCTGATGTTCTCGTAACTTCTCCAATGCAAGACGAAGGTGCTCTTCATGCTCTTCTCTGGTTCGGGAGTAGATAAGAATGTCGTCAAT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 5.90% | 2.58% | 3.98% | NA |
| All Indica | 2759 | 98.90% | 0.30% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 64.00% | 17.40% | 6.28% | 12.37% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.20% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 0.80% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 37.70% | 31.70% | 9.26% | 21.38% | NA |
| Tropical Japonica | 504 | 96.20% | 0.40% | 2.58% | 0.79% | NA |
| Japonica Intermediate | 241 | 80.10% | 7.50% | 4.56% | 7.88% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 3.33% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401346827 | A -> DEL | LOC_Os04g03190.1 | N | frameshift_variant | Average:7.815; most accessible tissue: Callus, score: 25.319 | N | N | N | N |
| vg0401346827 | A -> T | LOC_Os04g03190.1 | missense_variant ; p.Tyr723Phe; MODERATE | nonsynonymous_codon ; Y723F | Average:7.815; most accessible tissue: Callus, score: 25.319 | benign  |
-1.407 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401346827 | NA | 1.52E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401346827 | 2.55E-06 | 4.36E-10 | mr1182 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401346827 | NA | 1.21E-08 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401346827 | 1.14E-06 | 2.58E-09 | mr1650 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401346827 | NA | 1.64E-07 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401346827 | 2.91E-06 | 2.91E-06 | mr1670 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401346827 | NA | 1.35E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |