Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401334644:

Variant ID: vg0401334644 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1334644
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAGAAAAACGAATGATAAAAATATTAAACAAGTCAATAGCTTGATATATTTAAGAACGGACGAAGTAATGAAAGAGGAATAAGACCGTATTTAGGTGG[G/A]
ACTAAACCTATCAGATCGAATATTTGGATACTAATTATAAATATTAAACGTAGACTATAAATAAAACACATCCATAATTTTGGACTAATTCGCAAGATGA

Reverse complement sequence

TCATCTTGCGAATTAGTCCAAAATTATGGATGTGTTTTATTTATAGTCTACGTTTAATATTTATAATTAGTATCCAAATATTCGATCTGATAGGTTTAGT[C/T]
CCACCTAAATACGGTCTTATTCCTCTTTCATTACTTCGTCCGTTCTTAAATATATCAAGCTATTGACTTGTTTAATATTTTTATCATTCGTTTTTCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	25.60%	18.81%	16.69%	NA
All Indica	2759	14.90%	40.40%	17.98%	26.75%	NA
All Japonica	1512	70.00%	4.40%	23.54%	2.12%	NA
Aus	269	96.70%	1.10%	1.86%	0.37%	NA
Indica I	595	3.50%	66.70%	10.59%	19.16%	NA
Indica II	465	12.90%	26.50%	17.85%	42.80%	NA
Indica III	913	23.50%	31.10%	24.64%	20.70%	NA
Indica Intermediate	786	14.50%	39.60%	15.90%	30.03%	NA
Temperate Japonica	767	91.90%	1.80%	4.82%	1.43%	NA
Tropical Japonica	504	44.40%	9.10%	42.86%	3.57%	NA
Japonica Intermediate	241	53.50%	2.50%	42.74%	1.24%	NA
VI/Aromatic	96	77.10%	0.00%	20.83%	2.08%	NA
Intermediate	90	40.00%	28.90%	13.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401334644	G -> DEL	N	N	silent_mutation	Average:18.579; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0401334644	G -> A	LOC_Os04g03180.1	intron_variant ; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401334644	5.94E-06	3.70E-12	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	1.12E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	6.41E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	1.71E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	7.14E-06	NA	mr1033_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	3.16E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	1.49E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	3.54E-06	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	6.22E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	1.82E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	1.04E-06	NA	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	7.88E-08	2.71E-15	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	5.53E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	1.25E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334644	NA	2.78E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251