Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401334307:

Variant ID: vg0401334307 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1334307
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATCTATTCCATTATCTAAAAATATAAAATAAGAAAATATAAAATAAGAGATTTTGGAGGGATATACACATCTTACGACTATGAATCTGGACATGCT[C/T]
ATGTCCAGATTCATAATCTTAGTGTCACATCCCTCTAAAATCACTTATATTATGGGCCGGGGGGAGTATATCTATTAACATATACCATCCTCATTCTTTA

Reverse complement sequence

TAAAGAATGAGGATGGTATATGTTAATAGATATACTCCCCCCGGCCCATAATATAAGTGATTTTAGAGGGATGTGACACTAAGATTATGAATCTGGACAT[G/A]
AGCATGTCCAGATTCATAGTCGTAAGATGTGTATATCCCTCCAAAATCTCTTATTTTATATTTTCTTATTTTATATTTTTAGATAATGGAATAGATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	17.20%	0.32%	0.00%	NA
All Indica	2759	88.20%	11.70%	0.07%	0.00%	NA
All Japonica	1512	68.90%	31.00%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	80.90%	19.10%	0.00%	0.00%	NA
Indica III	913	83.70%	16.20%	0.11%	0.00%	NA
Indica Intermediate	786	90.10%	9.80%	0.13%	0.00%	NA
Temperate Japonica	767	94.90%	5.00%	0.13%	0.00%	NA
Tropical Japonica	504	40.90%	59.10%	0.00%	0.00%	NA
Japonica Intermediate	241	44.80%	54.80%	0.41%	0.00%	NA
VI/Aromatic	96	82.30%	6.20%	11.46%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401334307	C -> T	LOC_Os04g03180.1	intron_variant ; MODIFIER	silent_mutation	Average:40.699; most accessible tissue: Callus, score: 74.903	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401334307	NA	4.32E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	3.07E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	1.16E-06	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	3.96E-06	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	8.35E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	3.05E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	8.25E-07	mr1363_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	2.94E-06	mr1474_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	2.24E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	2.72E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	2.40E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	7.99E-06	mr1579_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	1.11E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	1.17E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401334307	NA	4.16E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251