Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0401302211:

Variant ID: vg0401302211 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1302211
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGTGCAAAGGGACATGTTCTCACATCAATCGCATGCAAGGTATATGCATTGTTGTAATTGTGATGCTGAAGGCACTGCTCACAAATCCTACATTATT[C/T]
AGCAGCACCACACAACAAGGAACTAGGCAAATTTAGTACAAGTTCAAGCCAAGTAAACTATCTGTCAATTTGGTCCGTAGAAAACATGGTTTGTTTAGTT

Reverse complement sequence

AACTAAACAAACCATGTTTTCTACGGACCAAATTGACAGATAGTTTACTTGGCTTGAACTTGTACTAAATTTGCCTAGTTCCTTGTTGTGTGGTGCTGCT[G/A]
AATAATGTAGGATTTGTGAGCAGTGCCTTCAGCATCACAATTACAACAATGCATATACCTTGCATGCGATTGATGTGAGAACATGTCCCTTTGCACTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 4.50% 0.68% 51.02% NA
All Indica  2759 37.60% 7.50% 0.83% 54.11% NA
All Japonica  1512 62.40% 0.30% 0.53% 36.77% NA
Aus  269 8.60% 0.00% 0.00% 91.45% NA
Indica I  595 71.40% 0.30% 1.01% 27.23% NA
Indica II  465 24.50% 17.60% 1.72% 56.13% NA
Indica III  913 26.10% 10.10% 0.22% 63.64% NA
Indica Intermediate  786 33.10% 3.80% 0.89% 62.21% NA
Temperate Japonica  767 56.30% 0.00% 0.91% 42.76% NA
Tropical Japonica  504 64.30% 0.20% 0.20% 35.32% NA
Japonica Intermediate  241 78.00% 1.20% 0.00% 20.75% NA
VI/Aromatic  96 20.80% 0.00% 0.00% 79.17% NA
Intermediate  90 48.90% 5.60% 1.11% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401302211 C -> DEL N N silent_mutation Average:19.602; most accessible tissue: Callus, score: 78.374 N N N N
vg0401302211 C -> T LOC_Os04g03120.1 upstream_gene_variant ; 1685.0bp to feature; MODIFIER silent_mutation Average:19.602; most accessible tissue: Callus, score: 78.374 N N N N
vg0401302211 C -> T LOC_Os04g03140.1 downstream_gene_variant ; 4122.0bp to feature; MODIFIER silent_mutation Average:19.602; most accessible tissue: Callus, score: 78.374 N N N N
vg0401302211 C -> T LOC_Os04g03130.1 intron_variant ; MODIFIER silent_mutation Average:19.602; most accessible tissue: Callus, score: 78.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401302211 NA 9.85E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401302211 NA 2.48E-06 mr1040_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401302211 7.36E-07 9.29E-09 mr1362_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401302211 NA 2.68E-07 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251