| Variant ID: vg0401293960 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1293960 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCGACCGCCAAACCAAAGTTGCATATTTCATCGCAGTCAAAACCACTTATCCCGGCAGTAAGTTGGCAGAATTATACTTTGCTAGGATAGTTTGTCTTC[A/T,G]
TGGAGTACCGAAGAGAATCGTCTCCGATCGGGGTAGCCAATTCACTACTAAGTTCTGGCAGAAATTGCAGGAAGAAATGGGAACTCATTTGAACTTTAGC
GCTAAAGTTCAAATGAGTTCCCATTTCTTCCTGCAATTTCTGCCAGAACTTAGTAGTGAATTGGCTACCCCGATCGGAGACGATTCTCTTCGGTACTCCA[T/A,C]
GAAGACAAACTATCCTAGCAAAGTATAATTCTGCCAACTTACTGCCGGGATAAGTGGTTTTGACTGCGATGAAATATGCAACTTTGGTTTGGCGGTCGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.10% | 5.90% | 2.54% | 42.36% | G: 0.13% |
| All Indica | 2759 | 44.30% | 6.40% | 2.97% | 46.14% | G: 0.22% |
| All Japonica | 1512 | 56.20% | 0.40% | 1.52% | 41.87% | NA |
| Aus | 269 | 66.90% | 28.60% | 4.09% | 0.37% | NA |
| Indica I | 595 | 72.40% | 0.00% | 1.68% | 25.38% | G: 0.50% |
| Indica II | 465 | 27.10% | 3.40% | 3.66% | 65.59% | G: 0.22% |
| Indica III | 913 | 33.40% | 12.00% | 3.94% | 50.60% | NA |
| Indica Intermediate | 786 | 45.80% | 6.40% | 2.42% | 45.17% | G: 0.25% |
| Temperate Japonica | 767 | 56.50% | 0.10% | 2.22% | 41.20% | NA |
| Tropical Japonica | 504 | 66.90% | 0.20% | 0.40% | 32.54% | NA |
| Japonica Intermediate | 241 | 33.20% | 1.70% | 1.66% | 63.49% | NA |
| VI/Aromatic | 96 | 17.70% | 10.40% | 3.12% | 68.75% | NA |
| Intermediate | 90 | 57.80% | 8.90% | 1.11% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401293960 | A -> DEL | N | N | silent_mutation | Average:15.155; most accessible tissue: Callus, score: 60.966 | N | N | N | N |
| vg0401293960 | A -> G | LOC_Os04g03120.1 | downstream_gene_variant ; 1669.0bp to feature; MODIFIER | silent_mutation | Average:15.155; most accessible tissue: Callus, score: 60.966 | N | N | N | N |
| vg0401293960 | A -> G | LOC_Os04g03110.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.155; most accessible tissue: Callus, score: 60.966 | N | N | N | N |
| vg0401293960 | A -> T | LOC_Os04g03120.1 | downstream_gene_variant ; 1669.0bp to feature; MODIFIER | silent_mutation | Average:15.155; most accessible tissue: Callus, score: 60.966 | N | N | N | N |
| vg0401293960 | A -> T | LOC_Os04g03110.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.155; most accessible tissue: Callus, score: 60.966 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401293960 | NA | 9.54E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401293960 | 4.83E-06 | NA | mr1741 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401293960 | 6.90E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401293960 | NA | 7.79E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |