\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401281473:

Variant ID: vg0401281473 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1281473
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAAGGCGTGATCATTGGTGTCGTTGACACAGGTTAAATAATTTAGTAAAAATATACTTTTCCAATAATCTAAAAATCAATGCTAGCTGCATGTCAAAC[A/C,T]
TGACAAGCTATTACACCCGGTGTCCTTTGTGGGGTGAGAATGGGAGGAATGGGGTAATTAAATTAGTACAAATGAATTGCCTATCTTCTGGCTTAAATTT

Reverse complement sequence

AAATTTAAGCCAGAAGATAGGCAATTCATTTGTACTAATTTAATTACCCCATTCCTCCCATTCTCACCCCACAAAGGACACCGGGTGTAATAGCTTGTCA[T/G,A]
GTTTGACATGCAGCTAGCATTGATTTTTAGATTATTGGAAAAGTATATTTTTACTAAATTATTTAACCTGTGTCAACGACACCAATGATCACGCCTTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.70% 12.10% 0.91% 37.83% T: 4.53%
All Indica  2759 33.50% 5.10% 0.98% 52.85% T: 7.50%
All Japonica  1512 69.10% 26.20% 0.79% 3.70% T: 0.20%
Aus  269 7.40% 5.90% 0.74% 85.87% NA
Indica I  595 67.20% 5.50% 0.34% 26.72% T: 0.17%
Indica II  465 18.30% 6.20% 0.86% 56.77% T: 17.85%
Indica III  913 24.60% 3.70% 0.33% 61.12% T: 10.19%
Indica Intermediate  786 27.40% 5.90% 2.29% 60.69% T: 3.82%
Temperate Japonica  767 50.70% 47.80% 1.04% 0.39% NA
Tropical Japonica  504 88.90% 1.20% 0.60% 9.33% NA
Japonica Intermediate  241 86.30% 9.50% 0.41% 2.49% T: 1.24%
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 42.20% 17.80% 2.22% 33.33% T: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401281473 A -> C LOC_Os04g03100.1 intron_variant ; MODIFIER silent_mutation Average:32.992; most accessible tissue: Callus, score: 73.201 N N N N
vg0401281473 A -> DEL N N silent_mutation Average:32.992; most accessible tissue: Callus, score: 73.201 N N N N
vg0401281473 A -> T LOC_Os04g03100.1 intron_variant ; MODIFIER silent_mutation Average:32.992; most accessible tissue: Callus, score: 73.201 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401281473 2.51E-09 1.66E-30 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 2.16E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 8.91E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 1.77E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 4.86E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 3.31E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 6.44E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 7.48E-08 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 2.13E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 2.39E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 1.06E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 3.65E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 1.68E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 1.16E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 4.06E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 5.42E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401281473 NA 1.94E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251