Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401257635:

Variant ID: vg0401257635 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1257635
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTGACTTTCTCTTTTTTATAATGTACCATTGAACTCATCAATTCCTTCTACAATATGCCATTGGATCATTTACTTTTTCAAAAATTACCCCAAATAC[C/T]
CTTACGTATAAGAAACAATTGATTGACTGGATAGAAGTTTTAAAAAGATATGAAATTCTTTGTGTAGTCTCCTTACATGATATATAAGCAGATTTTTTTA

Reverse complement sequence

TAAAAAAATCTGCTTATATATCATGTAAGGAGACTACACAAAGAATTTCATATCTTTTTAAAACTTCTATCCAGTCAATCAATTGTTTCTTATACGTAAG[G/A]
GTATTTGGGGTAATTTTTGAAAAAGTAAATGATCCAATGGCATATTGTAGAAGGAATTGATGAGTTCAATGGTACATTATAAAAAAGAGAAAGTCAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	44.30%	0.06%	0.00%	NA
All Indica	2759	45.60%	54.30%	0.07%	0.00%	NA
All Japonica	1512	86.30%	13.60%	0.07%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	67.60%	32.40%	0.00%	0.00%	NA
Indica II	465	36.60%	63.40%	0.00%	0.00%	NA
Indica III	913	46.70%	53.30%	0.00%	0.00%	NA
Indica Intermediate	786	33.20%	66.50%	0.25%	0.00%	NA
Temperate Japonica	767	91.30%	8.70%	0.00%	0.00%	NA
Tropical Japonica	504	82.70%	17.30%	0.00%	0.00%	NA
Japonica Intermediate	241	78.00%	21.60%	0.41%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401257635	C -> T	LOC_Os04g03050.1	intron_variant ; MODIFIER	silent_mutation	Average:30.192; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401257635	9.37E-06	9.37E-06	mr1030	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	1.50E-06	mr1036	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	2.42E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	1.27E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	2.04E-09	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	1.01E-09	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	2.30E-06	mr1155	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	1.08E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	5.07E-10	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	7.86E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	6.09E-07	mr1245	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	2.16E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	8.88E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	3.65E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	2.44E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	6.61E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	5.39E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	6.41E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	7.28E-06	mr1921	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	1.58E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	5.81E-08	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	9.06E-07	mr1713_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401257635	NA	3.43E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251