RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0401256003:

Variant ID: vg0401256003 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1256003
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTATCCCGTAGGTATCACGCCTGAGTCACCAAGCTTCGCTGATGATGGATATGGTCCCCCTCCATCCAAATGGAAAGGAATTTGCCAAGTCGGTCCCT[C/T]
GTTCGAAGCCAAAAGTTGCAACCGAAAACTTATCGGTGCACGGTGGTATATCGATGACGATACTCTAAGCAGCATGAGCAAGAATGAAATTCTATCTCCT

Reverse complement sequence

AGGAGATAGAATTTCATTCTTGCTCATGCTGCTTAGAGTATCGTCATCGATATACCACCGTGCACCGATAAGTTTTCGGTTGCAACTTTTGGCTTCGAAC[G/A]
AGGGACCGACTTGGCAAATTCCTTTCCATTTGGATGGAGGGGGACCATATCCATCATCAGCGAAGCTTGGTGACTCAGGCGTGATACCTACGGGATAAGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	6.20%	0.00%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	81.60%	18.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	69.00%	31.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401256003	C -> T	LOC_Os04g03050.1	missense_variant ; p.Ser181Leu; MODERATE	nonsynonymous_codon ; S181L	Average:59.038; most accessible tissue: Zhenshan97 young leaf, score: 78.044	possibly damaging	1.896	TOLERATED	0.37

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401256003	NA	1.05E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401256003	NA	5.92E-10	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	NA	2.62E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	6.59E-06	3.80E-09	mr1691	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	NA	4.10E-06	mr1030_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	NA	6.36E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	NA	3.18E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	NA	3.88E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	1.85E-07	NA	mr1670_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401256003	NA	6.17E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 11 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0401256003:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact