\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401249611:

Variant ID: vg0401249611 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1249611
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCCAATAACAGAAACATAGCAACCGATCGACACAAACATTATGAATTCGAAAGAGACAAATATGGATGTATATCATTAAGAAAAGATGCAAAAATAAT[A/G]
TCTTTGATGATAATATAAAACCTTAATTGAAAACGTACACAAATGTAGCAACTAACAAATGTAGCAACTAATAGACAAATAAGGGAAAACAACATTGCTT

Reverse complement sequence

AAGCAATGTTGTTTTCCCTTATTTGTCTATTAGTTGCTACATTTGTTAGTTGCTACATTTGTGTACGTTTTCAATTAAGGTTTTATATTATCATCAAAGA[T/C]
ATTATTTTTGCATCTTTTCTTAATGATATACATCCATATTTGTCTCTTTCGAATTCATAATGTTTGTGTCGATCGGTTGCTATGTTTCTGTTATTGGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 29.00% 0.23% 0.00% NA
All Indica  2759 85.00% 14.80% 0.18% 0.00% NA
All Japonica  1512 39.20% 60.40% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 77.20% 22.80% 0.00% 0.00% NA
Indica III  913 79.50% 20.30% 0.22% 0.00% NA
Indica Intermediate  786 86.50% 13.10% 0.38% 0.00% NA
Temperate Japonica  767 55.70% 44.10% 0.26% 0.00% NA
Tropical Japonica  504 18.30% 81.70% 0.00% 0.00% NA
Japonica Intermediate  241 30.70% 68.00% 1.24% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401249611 A -> G LOC_Os04g03040.1 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:30.162; most accessible tissue: Callus, score: 52.478 N N N N
vg0401249611 A -> G LOC_Os04g03050.1 intron_variant ; MODIFIER silent_mutation Average:30.162; most accessible tissue: Callus, score: 52.478 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401249611 NA 7.05E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 4.00E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 1.59E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 1.87E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 7.83E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 1.66E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 2.15E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 4.72E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 1.11E-06 mr1474_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611 NA 2.76E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251