\
| Variant ID: vg0401249611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1249611 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 76. )
TAGCCAATAACAGAAACATAGCAACCGATCGACACAAACATTATGAATTCGAAAGAGACAAATATGGATGTATATCATTAAGAAAAGATGCAAAAATAAT[A/G]
TCTTTGATGATAATATAAAACCTTAATTGAAAACGTACACAAATGTAGCAACTAACAAATGTAGCAACTAATAGACAAATAAGGGAAAACAACATTGCTT
AAGCAATGTTGTTTTCCCTTATTTGTCTATTAGTTGCTACATTTGTTAGTTGCTACATTTGTGTACGTTTTCAATTAAGGTTTTATATTATCATCAAAGA[T/C]
ATTATTTTTGCATCTTTTCTTAATGATATACATCCATATTTGTCTCTTTCGAATTCATAATGTTTGTGTCGATCGGTTGCTATGTTTCTGTTATTGGCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 29.00% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 14.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 39.20% | 60.40% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.50% | 20.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 13.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 55.70% | 44.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 18.30% | 81.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 68.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401249611 | A -> G | LOC_Os04g03040.1 | upstream_gene_variant ; 3684.0bp to feature; MODIFIER | silent_mutation | Average:30.162; most accessible tissue: Callus, score: 52.478 | N | N | N | N |
| vg0401249611 | A -> G | LOC_Os04g03050.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.162; most accessible tissue: Callus, score: 52.478 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401249611 | NA | 7.05E-08 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 4.00E-07 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 1.59E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 1.87E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 7.83E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 1.66E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 2.15E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 4.72E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 1.11E-06 | mr1474_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249611 | NA | 2.76E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |