Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401249611:

Variant ID: vg0401249611 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1249611
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCCAATAACAGAAACATAGCAACCGATCGACACAAACATTATGAATTCGAAAGAGACAAATATGGATGTATATCATTAAGAAAAGATGCAAAAATAAT[A/G]
TCTTTGATGATAATATAAAACCTTAATTGAAAACGTACACAAATGTAGCAACTAACAAATGTAGCAACTAATAGACAAATAAGGGAAAACAACATTGCTT

Reverse complement sequence

AAGCAATGTTGTTTTCCCTTATTTGTCTATTAGTTGCTACATTTGTTAGTTGCTACATTTGTGTACGTTTTCAATTAAGGTTTTATATTATCATCAAAGA[T/C]
ATTATTTTTGCATCTTTTCTTAATGATATACATCCATATTTGTCTCTTTCGAATTCATAATGTTTGTGTCGATCGGTTGCTATGTTTCTGTTATTGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	29.00%	0.23%	0.00%	NA
All Indica	2759	85.00%	14.80%	0.18%	0.00%	NA
All Japonica	1512	39.20%	60.40%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	77.20%	22.80%	0.00%	0.00%	NA
Indica III	913	79.50%	20.30%	0.22%	0.00%	NA
Indica Intermediate	786	86.50%	13.10%	0.38%	0.00%	NA
Temperate Japonica	767	55.70%	44.10%	0.26%	0.00%	NA
Tropical Japonica	504	18.30%	81.70%	0.00%	0.00%	NA
Japonica Intermediate	241	30.70%	68.00%	1.24%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401249611	A -> G	LOC_Os04g03040.1	upstream_gene_variant ; 3684.0bp to feature; MODIFIER	silent_mutation	Average:30.162; most accessible tissue: Callus, score: 52.478	N	N	N	N
vg0401249611	A -> G	LOC_Os04g03050.1	intron_variant ; MODIFIER	silent_mutation	Average:30.162; most accessible tissue: Callus, score: 52.478	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401249611	NA	7.05E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	4.00E-07	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	1.59E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	1.87E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	7.83E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	1.66E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	2.15E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	4.72E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	1.11E-06	mr1474_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401249611	NA	2.76E-06	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251