\
| Variant ID: vg0401249456 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1249456 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, G: 0.44, others allele: 0.00, population size: 85. )
GCGGGATGCATGGATCTAATCATCTAATTACAAATTTGTGTATTGCAAAATGTGATATGGAATGATTTTTTCAATGATAATATATATAGTTGTGAAAAGT[T/G]
ACAACGTTTCTTTATGATTAAATGGATTGCCTCTTATATGCAAAAGCTTACTAATAGCCAATAACAGAAACATAGCAACCGATCGACACAAACATTATGA
TCATAATGTTTGTGTCGATCGGTTGCTATGTTTCTGTTATTGGCTATTAGTAAGCTTTTGCATATAAGAGGCAATCCATTTAATCATAAAGAAACGTTGT[A/C]
ACTTTTCACAACTATATATATTATCATTGAAAAAATCATTCCATATCACATTTTGCAATACACAAATTTGTAATTAGATGATTAGATCCATGCATCCCGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 30.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 81.80% | 18.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 39.40% | 60.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.10% | 26.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 73.80% | 26.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 15.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 55.70% | 44.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 18.30% | 81.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.00% | 68.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 32.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401249456 | T -> G | LOC_Os04g03040.1 | upstream_gene_variant ; 3529.0bp to feature; MODIFIER | silent_mutation | Average:38.353; most accessible tissue: Callus, score: 69.665 | N | N | N | N |
| vg0401249456 | T -> G | LOC_Os04g03050.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.353; most accessible tissue: Callus, score: 69.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401249456 | NA | 5.54E-09 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 3.65E-08 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | 2.45E-06 | 2.45E-06 | mr1473 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 3.31E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | 9.59E-06 | 1.43E-08 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 2.26E-07 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 3.25E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 2.27E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 1.02E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 8.33E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 3.26E-07 | mr1474_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 6.27E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 4.03E-07 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401249456 | NA | 9.22E-06 | mr1566_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |