| Variant ID: vg0401228417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1228417 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 254. )
GATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGTGTTGTTAATTTGAAGGTAATCTCAATTTATTTGAAACAAATCACTTTTAT[A/G,C]
TTCGGTGTAACCACTATTTCCTCCCGATCCAGGGATTCAATTTAATATTTTTTCCCTAAAATTAAATACCAGGTTATGAGTTATAGTATTTGTTTACAAT
ATTGTAAACAAATACTATAACTCATAACCTGGTATTTAATTTTAGGGAAAAAATATTAAATTGAATCCCTGGATCGGGAGGAAATAGTGGTTACACCGAA[T/C,G]
ATAAAAGTGATTTGTTTCAAATAAATTGAGATTACCTTCAAATTAACAACACTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 7.70% | 0.17% | 0.00% | C: 0.06% |
| All Indica | 2759 | 99.20% | 0.70% | 0.04% | 0.00% | C: 0.04% |
| All Japonica | 1512 | 77.90% | 22.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 1.50% | 2.60% | 0.00% | C: 0.74% |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.13% | 0.00% | C: 0.13% |
| Temperate Japonica | 767 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401228417 | A -> C | LOC_Os04g03000.1 | upstream_gene_variant ; 4066.0bp to feature; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> C | LOC_Os04g03010.1 | downstream_gene_variant ; 809.0bp to feature; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> C | LOC_Os04g03020.1 | downstream_gene_variant ; 1485.0bp to feature; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> C | LOC_Os04g03010-LOC_Os04g03020 | intergenic_region ; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> G | LOC_Os04g03000.1 | upstream_gene_variant ; 4066.0bp to feature; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> G | LOC_Os04g03010.1 | downstream_gene_variant ; 809.0bp to feature; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> G | LOC_Os04g03020.1 | downstream_gene_variant ; 1485.0bp to feature; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0401228417 | A -> G | LOC_Os04g03010-LOC_Os04g03020 | intergenic_region ; MODIFIER | silent_mutation | Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401228417 | NA | 5.17E-14 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0401228417 | NA | 6.04E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0401228417 | NA | 4.32E-10 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401228417 | 4.73E-07 | NA | mr1924 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401228417 | NA | 3.12E-07 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401228417 | NA | 1.52E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401228417 | NA | 1.23E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401228417 | NA | 4.19E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |