\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401228417:

Variant ID: vg0401228417 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1228417
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGTGTTGTTAATTTGAAGGTAATCTCAATTTATTTGAAACAAATCACTTTTAT[A/G,C]
TTCGGTGTAACCACTATTTCCTCCCGATCCAGGGATTCAATTTAATATTTTTTCCCTAAAATTAAATACCAGGTTATGAGTTATAGTATTTGTTTACAAT

Reverse complement sequence

ATTGTAAACAAATACTATAACTCATAACCTGGTATTTAATTTTAGGGAAAAAATATTAAATTGAATCCCTGGATCGGGAGGAAATAGTGGTTACACCGAA[T/C,G]
ATAAAAGTGATTTGTTTCAAATAAATTGAGATTACCTTCAAATTAACAACACTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.70% 0.17% 0.00% C: 0.06%
All Indica  2759 99.20% 0.70% 0.04% 0.00% C: 0.04%
All Japonica  1512 77.90% 22.10% 0.00% 0.00% NA
Aus  269 95.20% 1.50% 2.60% 0.00% C: 0.74%
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.13% 0.00% C: 0.13%
Temperate Japonica  767 61.90% 38.10% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401228417 A -> C LOC_Os04g03000.1 upstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> C LOC_Os04g03010.1 downstream_gene_variant ; 809.0bp to feature; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> C LOC_Os04g03020.1 downstream_gene_variant ; 1485.0bp to feature; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> C LOC_Os04g03010-LOC_Os04g03020 intergenic_region ; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> G LOC_Os04g03000.1 upstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> G LOC_Os04g03010.1 downstream_gene_variant ; 809.0bp to feature; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> G LOC_Os04g03020.1 downstream_gene_variant ; 1485.0bp to feature; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0401228417 A -> G LOC_Os04g03010-LOC_Os04g03020 intergenic_region ; MODIFIER silent_mutation Average:38.205; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401228417 NA 5.17E-14 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401228417 NA 6.04E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401228417 NA 4.32E-10 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401228417 4.73E-07 NA mr1924 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401228417 NA 3.12E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401228417 NA 1.52E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401228417 NA 1.23E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401228417 NA 4.19E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251