\
| Variant ID: vg0401227972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1227972 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 82. )
TGGGTAGAAATACAAGGCCCCCTAGGAGGAGAGGGGACACAATACACACCCACAATCAACATACACGGAACAACAGAAGCCAACATACGCCAAGACAAGA[T/C]
GCCAGATATCGACTTCAGAGATAGGCACGGTTAATCCCCTACGGTGTCTCCGGATATTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGGGCAC
GTGCCCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAATATCCGGAGACACCGTAGGGGATTAACCGTGCCTATCTCTGAAGTCGATATCTGGC[A/G]
TCTTGTCTTGGCGTATGTTGGCTTCTGTTGTTCCGTGTATGTTGATTGTGGGTGTGTATTGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTCTACCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 15.80% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 91.60% | 7.70% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 70.60% | 29.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 93.70% | 5.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 94.00% | 3.90% | 2.15% | 0.00% | NA |
| Indica III | 913 | 85.70% | 14.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 7.50% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 50.20% | 49.30% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 71.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 13.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401227972 | T -> C | LOC_Os04g03000.1 | upstream_gene_variant ; 3621.0bp to feature; MODIFIER | silent_mutation | Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| vg0401227972 | T -> C | LOC_Os04g03010.1 | downstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| vg0401227972 | T -> C | LOC_Os04g03020.1 | downstream_gene_variant ; 1930.0bp to feature; MODIFIER | silent_mutation | Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| vg0401227972 | T -> C | LOC_Os04g03010-LOC_Os04g03020 | intergenic_region ; MODIFIER | silent_mutation | Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401227972 | 1.43E-06 | 4.69E-12 | mr1182 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401227972 | NA | 2.86E-08 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401227972 | NA | 7.33E-07 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401227972 | 2.01E-07 | 1.15E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401227972 | 4.87E-06 | 1.02E-08 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401227972 | NA | 5.46E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |