\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401227972:

Variant ID: vg0401227972 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1227972
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGTAGAAATACAAGGCCCCCTAGGAGGAGAGGGGACACAATACACACCCACAATCAACATACACGGAACAACAGAAGCCAACATACGCCAAGACAAGA[T/C]
GCCAGATATCGACTTCAGAGATAGGCACGGTTAATCCCCTACGGTGTCTCCGGATATTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGGGCAC

Reverse complement sequence

GTGCCCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAATATCCGGAGACACCGTAGGGGATTAACCGTGCCTATCTCTGAAGTCGATATCTGGC[A/G]
TCTTGTCTTGGCGTATGTTGGCTTCTGTTGTTCCGTGTATGTTGATTGTGGGTGTGTATTGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTCTACCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 15.80% 0.66% 0.00% NA
All Indica  2759 91.60% 7.70% 0.72% 0.00% NA
All Japonica  1512 70.60% 29.20% 0.26% 0.00% NA
Aus  269 93.70% 5.20% 1.12% 0.00% NA
Indica I  595 98.30% 1.30% 0.34% 0.00% NA
Indica II  465 94.00% 3.90% 2.15% 0.00% NA
Indica III  913 85.70% 14.00% 0.33% 0.00% NA
Indica Intermediate  786 91.90% 7.50% 0.64% 0.00% NA
Temperate Japonica  767 50.20% 49.30% 0.52% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 83.30% 13.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401227972 T -> C LOC_Os04g03000.1 upstream_gene_variant ; 3621.0bp to feature; MODIFIER silent_mutation Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0401227972 T -> C LOC_Os04g03010.1 downstream_gene_variant ; 364.0bp to feature; MODIFIER silent_mutation Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0401227972 T -> C LOC_Os04g03020.1 downstream_gene_variant ; 1930.0bp to feature; MODIFIER silent_mutation Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0401227972 T -> C LOC_Os04g03010-LOC_Os04g03020 intergenic_region ; MODIFIER silent_mutation Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401227972 1.43E-06 4.69E-12 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972 NA 2.86E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972 NA 7.33E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972 2.01E-07 1.15E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972 4.87E-06 1.02E-08 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972 NA 5.46E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251