Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401227972:

Variant ID: vg0401227972 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1227972
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGTAGAAATACAAGGCCCCCTAGGAGGAGAGGGGACACAATACACACCCACAATCAACATACACGGAACAACAGAAGCCAACATACGCCAAGACAAGA[T/C]
GCCAGATATCGACTTCAGAGATAGGCACGGTTAATCCCCTACGGTGTCTCCGGATATTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGGGCAC

Reverse complement sequence

GTGCCCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAATATCCGGAGACACCGTAGGGGATTAACCGTGCCTATCTCTGAAGTCGATATCTGGC[A/G]
TCTTGTCTTGGCGTATGTTGGCTTCTGTTGTTCCGTGTATGTTGATTGTGGGTGTGTATTGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTCTACCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	15.80%	0.66%	0.00%	NA
All Indica	2759	91.60%	7.70%	0.72%	0.00%	NA
All Japonica	1512	70.60%	29.20%	0.26%	0.00%	NA
Aus	269	93.70%	5.20%	1.12%	0.00%	NA
Indica I	595	98.30%	1.30%	0.34%	0.00%	NA
Indica II	465	94.00%	3.90%	2.15%	0.00%	NA
Indica III	913	85.70%	14.00%	0.33%	0.00%	NA
Indica Intermediate	786	91.90%	7.50%	0.64%	0.00%	NA
Temperate Japonica	767	50.20%	49.30%	0.52%	0.00%	NA
Tropical Japonica	504	93.80%	6.20%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	71.90%	1.04%	0.00%	NA
Intermediate	90	83.30%	13.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401227972	T -> C	LOC_Os04g03000.1	upstream_gene_variant ; 3621.0bp to feature; MODIFIER	silent_mutation	Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg0401227972	T -> C	LOC_Os04g03010.1	downstream_gene_variant ; 364.0bp to feature; MODIFIER	silent_mutation	Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg0401227972	T -> C	LOC_Os04g03020.1	downstream_gene_variant ; 1930.0bp to feature; MODIFIER	silent_mutation	Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg0401227972	T -> C	LOC_Os04g03010-LOC_Os04g03020	intergenic_region ; MODIFIER	silent_mutation	Average:21.073; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401227972	1.43E-06	4.69E-12	mr1182	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972	NA	2.86E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972	NA	7.33E-07	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972	2.01E-07	1.15E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972	4.87E-06	1.02E-08	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401227972	NA	5.46E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251