\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401225967:

Variant ID: vg0401225967 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1225967
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGAATTCTATATGAAAACGACAAGGACTACTCGGATTGTATCCATATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACA[A/T]
GGCCCCCCTAGGAGGAGAGGGGACACAATACACACCCACAATCAACATACATGGAACAACAGAAGCCAACATACGCCAAGACAAGACGCCGGATATCGAC

Reverse complement sequence

GTCGATATCCGGCGTCTTGTCTTGGCGTATGTTGGCTTCTGTTGTTCCATGTATGTTGATTGTGGGTGTGTATTGTGTCCCCTCTCCTCCTAGGGGGGCC[T/A]
TGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAATATGGATACAATCCGAGTAGTCCTTGTCGTTTTCATATAGAATTCTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.40% 4.40% 23.85% 42.34% NA
All Indica  2759 23.20% 7.50% 23.99% 45.34% NA
All Japonica  1512 38.20% 0.10% 14.95% 46.69% NA
Aus  269 23.40% 0.00% 71.75% 4.83% NA
Indica I  595 11.80% 0.20% 16.13% 71.93% NA
Indica II  465 30.50% 18.70% 28.60% 22.15% NA
Indica III  913 20.20% 9.40% 21.91% 48.52% NA
Indica Intermediate  786 31.00% 4.10% 29.64% 35.24% NA
Temperate Japonica  767 56.60% 0.00% 12.65% 30.77% NA
Tropical Japonica  504 18.50% 0.00% 20.04% 61.51% NA
Japonica Intermediate  241 21.20% 0.80% 11.62% 66.39% NA
VI/Aromatic  96 78.10% 0.00% 14.58% 7.29% NA
Intermediate  90 35.60% 2.20% 35.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401225967 A -> DEL N N silent_mutation Average:43.124; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0401225967 A -> T LOC_Os04g03000.1 upstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:43.124; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0401225967 A -> T LOC_Os04g03010.1 upstream_gene_variant ; 526.0bp to feature; MODIFIER silent_mutation Average:43.124; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0401225967 A -> T LOC_Os04g02990.1 downstream_gene_variant ; 4538.0bp to feature; MODIFIER silent_mutation Average:43.124; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0401225967 A -> T LOC_Os04g03020.1 downstream_gene_variant ; 3935.0bp to feature; MODIFIER silent_mutation Average:43.124; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0401225967 A -> T LOC_Os04g03000-LOC_Os04g03010 intergenic_region ; MODIFIER silent_mutation Average:43.124; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401225967 9.43E-06 NA mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401225967 2.12E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401225967 7.90E-07 NA mr1121_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251