\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401225551:

Variant ID: vg0401225551 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 1225551
Reference Allele: TAlternative Allele: C,TC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGTATAATATAATTATATACCATGTTGGGTGAAAACAAGCATTATCAAAGCCCAAAATCATCTTTCCTAATAGTACTATATTTTTTTCATATATTTTTT[T/C,TC]
ATAATTTTCTGCTCAAATGACCTTTATTTGCAGTAGTAACAAAAAATAACATTTATTTTCACTCTTAGGATGCCTGGGGTAAAGTTTATCGCCTCTTGAA

Reverse complement sequence

TTCAAGAGGCGATAAACTTTACCCCAGGCATCCTAAGAGTGAAAATAAATGTTATTTTTTGTTACTACTGCAAATAAAGGTCATTTGAGCAGAAAATTAT[A/G,GA]
AAAAAATATATGAAAAAAATATAGTACTATTAGGAAAGATGATTTTGGGCTTTGATAATGCTTGTTTTCACCCAACATGGTATATAATTATATTATACCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 7.60% 0.17% 0.00% TC: 4.49%
All Indica  2759 91.40% 0.90% 0.14% 0.00% TC: 7.58%
All Japonica  1512 77.90% 21.80% 0.26% 0.00% TC: 0.07%
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.17% 0.00% TC: 0.17%
Indica II  465 80.00% 0.90% 0.00% 0.00% TC: 19.14%
Indica III  913 89.40% 1.00% 0.22% 0.00% TC: 9.42%
Indica Intermediate  786 95.00% 0.60% 0.13% 0.00% TC: 4.20%
Temperate Japonica  767 62.10% 37.50% 0.39% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 8.70% 0.41% 0.00% TC: 0.41%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 0.00% 0.00% TC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401225551 T -> C LOC_Os04g03000.1 upstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> C LOC_Os04g03010.1 upstream_gene_variant ; 942.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> C LOC_Os04g02990.1 downstream_gene_variant ; 4122.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> C LOC_Os04g03020.1 downstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> C LOC_Os04g03000-LOC_Os04g03010 intergenic_region ; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> TC LOC_Os04g03000.1 upstream_gene_variant ; 1201.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> TC LOC_Os04g03010.1 upstream_gene_variant ; 941.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> TC LOC_Os04g02990.1 downstream_gene_variant ; 4123.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> TC LOC_Os04g03020.1 downstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N
vg0401225551 T -> TC LOC_Os04g03000-LOC_Os04g03010 intergenic_region ; MODIFIER silent_mutation Average:57.063; most accessible tissue: Callus, score: 77.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401225551 NA 1.82E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401225551 NA 8.83E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401225551 NA 1.94E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401225551 NA 1.08E-06 mr1668 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401225551 NA 4.17E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401225551 NA 8.28E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401225551 NA 1.39E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251