\
| Variant ID: vg0401225551 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 1225551 |
| Reference Allele: T | Alternative Allele: C,TC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGTATAATATAATTATATACCATGTTGGGTGAAAACAAGCATTATCAAAGCCCAAAATCATCTTTCCTAATAGTACTATATTTTTTTCATATATTTTTT[T/C,TC]
ATAATTTTCTGCTCAAATGACCTTTATTTGCAGTAGTAACAAAAAATAACATTTATTTTCACTCTTAGGATGCCTGGGGTAAAGTTTATCGCCTCTTGAA
TTCAAGAGGCGATAAACTTTACCCCAGGCATCCTAAGAGTGAAAATAAATGTTATTTTTTGTTACTACTGCAAATAAAGGTCATTTGAGCAGAAAATTAT[A/G,GA]
AAAAAATATATGAAAAAAATATAGTACTATTAGGAAAGATGATTTTGGGCTTTGATAATGCTTGTTTTCACCCAACATGGTATATAATTATATTATACCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.70% | 7.60% | 0.17% | 0.00% | TC: 4.49% |
| All Indica | 2759 | 91.40% | 0.90% | 0.14% | 0.00% | TC: 7.58% |
| All Japonica | 1512 | 77.90% | 21.80% | 0.26% | 0.00% | TC: 0.07% |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.00% | 0.17% | 0.00% | TC: 0.17% |
| Indica II | 465 | 80.00% | 0.90% | 0.00% | 0.00% | TC: 19.14% |
| Indica III | 913 | 89.40% | 1.00% | 0.22% | 0.00% | TC: 9.42% |
| Indica Intermediate | 786 | 95.00% | 0.60% | 0.13% | 0.00% | TC: 4.20% |
| Temperate Japonica | 767 | 62.10% | 37.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 8.70% | 0.41% | 0.00% | TC: 0.41% |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 0.00% | 0.00% | TC: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401225551 | T -> C | LOC_Os04g03000.1 | upstream_gene_variant ; 1200.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> C | LOC_Os04g03010.1 | upstream_gene_variant ; 942.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> C | LOC_Os04g02990.1 | downstream_gene_variant ; 4122.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> C | LOC_Os04g03020.1 | downstream_gene_variant ; 4351.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> C | LOC_Os04g03000-LOC_Os04g03010 | intergenic_region ; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> TC | LOC_Os04g03000.1 | upstream_gene_variant ; 1201.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> TC | LOC_Os04g03010.1 | upstream_gene_variant ; 941.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> TC | LOC_Os04g02990.1 | downstream_gene_variant ; 4123.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> TC | LOC_Os04g03020.1 | downstream_gene_variant ; 4350.0bp to feature; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| vg0401225551 | T -> TC | LOC_Os04g03000-LOC_Os04g03010 | intergenic_region ; MODIFIER | silent_mutation | Average:57.063; most accessible tissue: Callus, score: 77.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401225551 | NA | 1.82E-13 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0401225551 | NA | 8.83E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0401225551 | NA | 1.94E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401225551 | NA | 1.08E-06 | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401225551 | NA | 4.17E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401225551 | NA | 8.28E-07 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401225551 | NA | 1.39E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |