\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401219405:

Variant ID: vg0401219405 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1219405
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCCTATTGTTCTGTGCTGAATTTGGATATTTTTTATAATATAACTATTACTTTCGCTGCCTACACCATGTAGGATGTTTTTTTTAAATAATTTGAGTT[A/G]
TTTTATTGCTACGTATGGGTATATATGAATCAAATTGTTACACCTAGGTATATAACTAGAGGTTGAAAATTTTCAAAAATTTGAGTGTGATTAGTTATTA

Reverse complement sequence

TAATAACTAATCACACTCAAATTTTTGAAAATTTTCAACCTCTAGTTATATACCTAGGTGTAACAATTTGATTCATATATACCCATACGTAGCAATAAAA[T/C]
AACTCAAATTATTTAAAAAAAACATCCTACATGGTGTAGGCAGCGAAAGTAATAGTTATATTATAAAAAATATCCAAATTCAGCACAGAACAATAGGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 29.70% 0.30% 0.32% NA
All Indica  2759 91.40% 7.60% 0.40% 0.54% NA
All Japonica  1512 31.00% 68.90% 0.07% 0.00% NA
Aus  269 85.90% 13.80% 0.37% 0.00% NA
Indica I  595 96.00% 2.00% 1.01% 1.01% NA
Indica II  465 95.30% 3.90% 0.22% 0.65% NA
Indica III  913 89.90% 9.70% 0.00% 0.33% NA
Indica Intermediate  786 87.40% 11.70% 0.51% 0.38% NA
Temperate Japonica  767 39.60% 60.40% 0.00% 0.00% NA
Tropical Japonica  504 20.00% 80.00% 0.00% 0.00% NA
Japonica Intermediate  241 26.60% 73.00% 0.41% 0.00% NA
VI/Aromatic  96 14.60% 84.40% 1.04% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401219405 A -> DEL N N silent_mutation Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg0401219405 A -> G LOC_Os04g02980.1 downstream_gene_variant ; 379.0bp to feature; MODIFIER silent_mutation Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg0401219405 A -> G LOC_Os04g03000.1 downstream_gene_variant ; 2501.0bp to feature; MODIFIER silent_mutation Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 N N N N
vg0401219405 A -> G LOC_Os04g02990.1 intron_variant ; MODIFIER silent_mutation Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401219405 NA 1.00E-21 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405 NA 9.90E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405 NA 2.25E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405 NA 7.97E-12 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405 NA 8.22E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251