Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401219405:

Variant ID: vg0401219405 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1219405
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCCTATTGTTCTGTGCTGAATTTGGATATTTTTTATAATATAACTATTACTTTCGCTGCCTACACCATGTAGGATGTTTTTTTTAAATAATTTGAGTT[A/G]
TTTTATTGCTACGTATGGGTATATATGAATCAAATTGTTACACCTAGGTATATAACTAGAGGTTGAAAATTTTCAAAAATTTGAGTGTGATTAGTTATTA

Reverse complement sequence

TAATAACTAATCACACTCAAATTTTTGAAAATTTTCAACCTCTAGTTATATACCTAGGTGTAACAATTTGATTCATATATACCCATACGTAGCAATAAAA[T/C]
AACTCAAATTATTTAAAAAAAACATCCTACATGGTGTAGGCAGCGAAAGTAATAGTTATATTATAAAAAATATCCAAATTCAGCACAGAACAATAGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	29.70%	0.30%	0.32%	NA
All Indica	2759	91.40%	7.60%	0.40%	0.54%	NA
All Japonica	1512	31.00%	68.90%	0.07%	0.00%	NA
Aus	269	85.90%	13.80%	0.37%	0.00%	NA
Indica I	595	96.00%	2.00%	1.01%	1.01%	NA
Indica II	465	95.30%	3.90%	0.22%	0.65%	NA
Indica III	913	89.90%	9.70%	0.00%	0.33%	NA
Indica Intermediate	786	87.40%	11.70%	0.51%	0.38%	NA
Temperate Japonica	767	39.60%	60.40%	0.00%	0.00%	NA
Tropical Japonica	504	20.00%	80.00%	0.00%	0.00%	NA
Japonica Intermediate	241	26.60%	73.00%	0.41%	0.00%	NA
VI/Aromatic	96	14.60%	84.40%	1.04%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401219405	A -> DEL	N	N	silent_mutation	Average:32.183; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0401219405	A -> G	LOC_Os04g02980.1	downstream_gene_variant ; 379.0bp to feature; MODIFIER	silent_mutation	Average:32.183; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0401219405	A -> G	LOC_Os04g03000.1	downstream_gene_variant ; 2501.0bp to feature; MODIFIER	silent_mutation	Average:32.183; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0401219405	A -> G	LOC_Os04g02990.1	intron_variant ; MODIFIER	silent_mutation	Average:32.183; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401219405	NA	1.00E-21	mr1676	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405	NA	9.90E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405	NA	2.25E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405	NA	7.97E-12	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401219405	NA	8.22E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251