\
| Variant ID: vg0401219405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1219405 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 84. )
TGCCCTATTGTTCTGTGCTGAATTTGGATATTTTTTATAATATAACTATTACTTTCGCTGCCTACACCATGTAGGATGTTTTTTTTAAATAATTTGAGTT[A/G]
TTTTATTGCTACGTATGGGTATATATGAATCAAATTGTTACACCTAGGTATATAACTAGAGGTTGAAAATTTTCAAAAATTTGAGTGTGATTAGTTATTA
TAATAACTAATCACACTCAAATTTTTGAAAATTTTCAACCTCTAGTTATATACCTAGGTGTAACAATTTGATTCATATATACCCATACGTAGCAATAAAA[T/C]
AACTCAAATTATTTAAAAAAAACATCCTACATGGTGTAGGCAGCGAAAGTAATAGTTATATTATAAAAAATATCCAAATTCAGCACAGAACAATAGGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 29.70% | 0.30% | 0.32% | NA |
| All Indica | 2759 | 91.40% | 7.60% | 0.40% | 0.54% | NA |
| All Japonica | 1512 | 31.00% | 68.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 85.90% | 13.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.00% | 2.00% | 1.01% | 1.01% | NA |
| Indica II | 465 | 95.30% | 3.90% | 0.22% | 0.65% | NA |
| Indica III | 913 | 89.90% | 9.70% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 87.40% | 11.70% | 0.51% | 0.38% | NA |
| Temperate Japonica | 767 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 20.00% | 80.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.60% | 73.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 84.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401219405 | A -> DEL | N | N | silent_mutation | Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0401219405 | A -> G | LOC_Os04g02980.1 | downstream_gene_variant ; 379.0bp to feature; MODIFIER | silent_mutation | Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0401219405 | A -> G | LOC_Os04g03000.1 | downstream_gene_variant ; 2501.0bp to feature; MODIFIER | silent_mutation | Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg0401219405 | A -> G | LOC_Os04g02990.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.183; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401219405 | NA | 1.00E-21 | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401219405 | NA | 9.90E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401219405 | NA | 2.25E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401219405 | NA | 7.97E-12 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401219405 | NA | 8.22E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |