\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401213700:

Variant ID: vg0401213700 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1213700
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTAATATGGGGATGATATTATTATAAGTCAATTACGACCACTAGAACGGTCATTCAAGTGATATTCTTATAAAATTGAAAAAACCAGTGGCAAATTCG[C/T]
AAGTTCCCATGTTGTTATTGGTGTTATTGACAGAGGTAATAAGTAGTTAAGGTCTAAAACAGTACCACGTGCAACCAGAGACTCCCTACCGTAAAATATA

Reverse complement sequence

TATATTTTACGGTAGGGAGTCTCTGGTTGCACGTGGTACTGTTTTAGACCTTAACTACTTATTACCTCTGTCAATAACACCAATAACAACATGGGAACTT[G/A]
CGAATTTGCCACTGGTTTTTTCAATTTTATAAGAATATCACTTGAATGACCGTTCTAGTGGTCGTAATTGACTTATAATAATATCATCCCCATATTAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.00% 0.02% 0.40% NA
All Indica  2759 71.60% 28.30% 0.00% 0.04% NA
All Japonica  1512 87.10% 11.70% 0.00% 1.19% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 6.60% 0.00% 0.00% NA
Indica II  465 50.80% 49.20% 0.00% 0.00% NA
Indica III  913 79.30% 20.60% 0.00% 0.11% NA
Indica Intermediate  786 58.50% 41.50% 0.00% 0.00% NA
Temperate Japonica  767 80.60% 19.40% 0.00% 0.00% NA
Tropical Japonica  504 93.10% 3.40% 0.00% 3.57% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401213700 C -> DEL N N silent_mutation Average:38.348; most accessible tissue: Callus, score: 74.742 N N N N
vg0401213700 C -> T LOC_Os04g02990.1 upstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:38.348; most accessible tissue: Callus, score: 74.742 N N N N
vg0401213700 C -> T LOC_Os04g02980.1 intron_variant ; MODIFIER silent_mutation Average:38.348; most accessible tissue: Callus, score: 74.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401213700 1.20E-06 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 6.62E-06 7.26E-14 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 1.98E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 2.10E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 2.28E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 2.44E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 4.59E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 4.06E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 8.65E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 9.69E-06 mr1348_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 2.37E-12 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401213700 NA 5.20E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251