\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401206110:

Variant ID: vg0401206110 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1206110
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTGGTGTTAATATACAAATTTGAGGTCTCTAAAAGGTTACCAACCGGGACTAAAGATGTAGCTTTACTCCTGGGTATTTGAACCGGGACTAAAGAC[C/T]
GCCATCTTTAGTCCTGGATTCTCCCTCCCGGTTCGCTACCCAGGAGTAAAGGGGGTTGCGAACTGGGAGAGATGAGCAGTTCTCCAGTAGTGCAAGTTAT

Reverse complement sequence

ATAACTTGCACTACTGGAGAACTGCTCATCTCTCCCAGTTCGCAACCCCCTTTACTCCTGGGTAGCGAACCGGGAGGGAGAATCCAGGACTAAAGATGGC[G/A]
GTCTTTAGTCCCGGTTCAAATACCCAGGAGTAAAGCTACATCTTTAGTCCCGGTTGGTAACCTTTTAGAGACCTCAAATTTGTATATTAACACCAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 16.70% 0.15% 0.00% NA
All Indica  2759 72.40% 27.30% 0.25% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 51.00% 49.00% 0.00% 0.00% NA
Indica III  913 79.80% 20.00% 0.11% 0.00% NA
Indica Intermediate  786 59.80% 39.60% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401206110 C -> T LOC_Os04g02980.1 upstream_gene_variant ; 3774.0bp to feature; MODIFIER silent_mutation Average:49.423; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0401206110 C -> T LOC_Os04g02970.1 downstream_gene_variant ; 3193.0bp to feature; MODIFIER silent_mutation Average:49.423; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0401206110 C -> T LOC_Os04g02970-LOC_Os04g02980 intergenic_region ; MODIFIER silent_mutation Average:49.423; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401206110 NA 1.23E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 1.33E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 8.38E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 4.30E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 4.29E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 9.43E-08 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 6.79E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 1.06E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 5.77E-11 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 5.45E-08 mr1174_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 1.86E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 2.43E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401206110 NA 1.87E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251