\
| Variant ID: vg0401206110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1206110 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )
TTTTTTGGTGTTAATATACAAATTTGAGGTCTCTAAAAGGTTACCAACCGGGACTAAAGATGTAGCTTTACTCCTGGGTATTTGAACCGGGACTAAAGAC[C/T]
GCCATCTTTAGTCCTGGATTCTCCCTCCCGGTTCGCTACCCAGGAGTAAAGGGGGTTGCGAACTGGGAGAGATGAGCAGTTCTCCAGTAGTGCAAGTTAT
ATAACTTGCACTACTGGAGAACTGCTCATCTCTCCCAGTTCGCAACCCCCTTTACTCCTGGGTAGCGAACCGGGAGGGAGAATCCAGGACTAAAGATGGC[G/A]
GTCTTTAGTCCCGGTTCAAATACCCAGGAGTAAAGCTACATCTTTAGTCCCGGTTGGTAACCTTTTAGAGACCTCAAATTTGTATATTAACACCAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.20% | 16.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 72.40% | 27.30% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.80% | 20.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 59.80% | 39.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401206110 | C -> T | LOC_Os04g02980.1 | upstream_gene_variant ; 3774.0bp to feature; MODIFIER | silent_mutation | Average:49.423; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0401206110 | C -> T | LOC_Os04g02970.1 | downstream_gene_variant ; 3193.0bp to feature; MODIFIER | silent_mutation | Average:49.423; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0401206110 | C -> T | LOC_Os04g02970-LOC_Os04g02980 | intergenic_region ; MODIFIER | silent_mutation | Average:49.423; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401206110 | NA | 1.23E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 1.33E-08 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 8.38E-06 | mr1592 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 4.30E-07 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 4.29E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 9.43E-08 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 6.79E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 1.06E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 5.77E-11 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 5.45E-08 | mr1174_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 1.86E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 2.43E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401206110 | NA | 1.87E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |