\
| Variant ID: vg0401200371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1200371 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTGACGGGCATTAACTATAGCTATTTCTGGATTATCCGCGTGGGTGCACACGAGTGAGGGCAGGGCTAGCCAAAAAAATAAAATTTATTTATTTCTGGAT[T/C]
ATACTCATCTATGACGGGTATTAACTGGCTGGCCAAAAAATAAAATTTATTTATTTCTGGATTATACTCATTTGTGACGGGCATTAATTATAGCCATAGT
ACTATGGCTATAATTAATGCCCGTCACAAATGAGTATAATCCAGAAATAAATAAATTTTATTTTTTGGCCAGCCAGTTAATACCCGTCATAGATGAGTAT[A/G]
ATCCAGAAATAAATAAATTTTATTTTTTTGGCTAGCCCTGCCCTCACTCGTGTGCACCCACGCGGATAATCCAGAAATAGCTATAGTTAATGCCCGTCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 2.20% | 1.90% | 4.57% | NA |
| All Indica | 2759 | 91.30% | 2.60% | 2.17% | 3.91% | NA |
| All Japonica | 1512 | 94.20% | 0.70% | 0.20% | 4.89% | NA |
| Aus | 269 | 74.30% | 6.30% | 8.92% | 10.41% | NA |
| Indica I | 595 | 87.70% | 1.30% | 3.53% | 7.39% | NA |
| Indica II | 465 | 98.90% | 0.20% | 0.00% | 0.86% | NA |
| Indica III | 913 | 88.70% | 4.60% | 2.85% | 3.83% | NA |
| Indica Intermediate | 786 | 92.50% | 2.70% | 1.65% | 3.18% | NA |
| Temperate Japonica | 767 | 93.90% | 0.00% | 0.13% | 6.00% | NA |
| Tropical Japonica | 504 | 91.90% | 2.20% | 0.40% | 5.56% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 3.10% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 90.00% | 3.30% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401200371 | T -> C | LOC_Os04g02970.1 | upstream_gene_variant ; 831.0bp to feature; MODIFIER | silent_mutation | Average:52.939; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0401200371 | T -> C | LOC_Os04g02960.1 | downstream_gene_variant ; 3275.0bp to feature; MODIFIER | silent_mutation | Average:52.939; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0401200371 | T -> C | LOC_Os04g02960-LOC_Os04g02970 | intergenic_region ; MODIFIER | silent_mutation | Average:52.939; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg0401200371 | T -> DEL | N | N | silent_mutation | Average:52.939; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401200371 | NA | 3.54E-06 | mr1107 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401200371 | NA | 6.18E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401200371 | 5.84E-06 | 5.83E-06 | mr1381 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401200371 | NA | 9.13E-06 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401200371 | 5.03E-06 | NA | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |