\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401198560:

Variant ID: vg0401198560 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1198560
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTCCACTAGTACAGATCCTTCTATCTGTGACGGGCTCTAATATGCTTAGAAATAGCGGGCCGTCACAAGGAAGTCATCTCAATCGGGCCGAAAAGTG[C/T]
CCGATTGAGATATAGTCGTACAGACATGTTAGATGGGTATAAAACTTAAGACTGTCACGGATGACATCTATCAGTGACGGGCCGTAGTTTAGGTCCGATT

Reverse complement sequence

AATCGGACCTAAACTACGGCCCGTCACTGATAGATGTCATCCGTGACAGTCTTAAGTTTTATACCCATCTAACATGTCTGTACGACTATATCTCAATCGG[G/A]
CACTTTTCGGCCCGATTGAGATGACTTCCTTGTGACGGCCCGCTATTTCTAAGCATATTAGAGCCCGTCACAGATAGAAGGATCTGTACTAGTGGAGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 16.80% 0.42% 1.18% NA
All Indica  2759 71.70% 27.40% 0.65% 0.29% NA
All Japonica  1512 96.20% 0.50% 0.13% 3.17% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 47.70% 49.50% 2.80% 0.00% NA
Indica III  913 80.10% 19.80% 0.11% 0.00% NA
Indica Intermediate  786 58.90% 39.60% 0.51% 1.02% NA
Temperate Japonica  767 93.20% 0.40% 0.13% 6.26% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401198560 C -> DEL N N silent_mutation Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0401198560 C -> T LOC_Os04g02970.1 upstream_gene_variant ; 2642.0bp to feature; MODIFIER silent_mutation Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0401198560 C -> T LOC_Os04g02960.1 downstream_gene_variant ; 1464.0bp to feature; MODIFIER silent_mutation Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0401198560 C -> T LOC_Os04g02960-LOC_Os04g02970 intergenic_region ; MODIFIER silent_mutation Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401198560 NA 3.61E-10 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 2.08E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 3.81E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 1.41E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 5.15E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 1.71E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 7.66E-07 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 6.41E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 2.77E-12 mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 8.59E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 9.18E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 1.89E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 5.28E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 1.80E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560 NA 1.58E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251