Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401198560:

Variant ID: vg0401198560 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1198560
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTCCACTAGTACAGATCCTTCTATCTGTGACGGGCTCTAATATGCTTAGAAATAGCGGGCCGTCACAAGGAAGTCATCTCAATCGGGCCGAAAAGTG[C/T]
CCGATTGAGATATAGTCGTACAGACATGTTAGATGGGTATAAAACTTAAGACTGTCACGGATGACATCTATCAGTGACGGGCCGTAGTTTAGGTCCGATT

Reverse complement sequence

AATCGGACCTAAACTACGGCCCGTCACTGATAGATGTCATCCGTGACAGTCTTAAGTTTTATACCCATCTAACATGTCTGTACGACTATATCTCAATCGG[G/A]
CACTTTTCGGCCCGATTGAGATGACTTCCTTGTGACGGCCCGCTATTTCTAAGCATATTAGAGCCCGTCACAGATAGAAGGATCTGTACTAGTGGAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	16.80%	0.42%	1.18%	NA
All Indica	2759	71.70%	27.40%	0.65%	0.29%	NA
All Japonica	1512	96.20%	0.50%	0.13%	3.17%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	47.70%	49.50%	2.80%	0.00%	NA
Indica III	913	80.10%	19.80%	0.11%	0.00%	NA
Indica Intermediate	786	58.90%	39.60%	0.51%	1.02%	NA
Temperate Japonica	767	93.20%	0.40%	0.13%	6.26%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401198560	C -> DEL	N	N	silent_mutation	Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0401198560	C -> T	LOC_Os04g02970.1	upstream_gene_variant ; 2642.0bp to feature; MODIFIER	silent_mutation	Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0401198560	C -> T	LOC_Os04g02960.1	downstream_gene_variant ; 1464.0bp to feature; MODIFIER	silent_mutation	Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0401198560	C -> T	LOC_Os04g02960-LOC_Os04g02970	intergenic_region ; MODIFIER	silent_mutation	Average:58.708; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401198560	NA	3.61E-10	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	2.08E-08	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	3.81E-07	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	1.41E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	5.15E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	1.71E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	7.66E-07	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	6.41E-07	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	2.77E-12	mr1174_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	8.59E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	9.18E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	1.89E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	5.28E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	1.80E-10	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401198560	NA	1.58E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251