\
| Variant ID: vg0401189541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1189541 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTGTCCTCCTGGAAACTGCAAGTCAGTTCAGTGAGATACAGAAGTACACAGACGAGGAGTAAGTGTAGTAGCTAGGAAATCAATACTAATTACCATATG[A/G]
TTCAATACATATACATTTTTTTCAATTAAGATAATAGAAAAATTCTGGCCTTTACCTAGAAGTAAGCTCAAGTCAAATTGTTATTTCGTACCCCTCCGTT
AACGGAGGGGTACGAAATAACAATTTGACTTGAGCTTACTTCTAGGTAAAGGCCAGAATTTTTCTATTATCTTAATTGAAAAAAATGTATATGTATTGAA[T/C]
CATATGGTAATTAGTATTGATTTCCTAGCTACTACACTTACTCCTCGTCTGTGTACTTCTGTATCTCACTGAACTGACTTGCAGTTTCCAGGAGGACAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 13.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 77.60% | 22.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 36.50% | 63.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.20% | 10.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401189541 | A -> G | LOC_Os04g02960.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.09; most accessible tissue: Callus, score: 91.697 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401189541 | NA | 5.80E-11 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401189541 | NA | 2.97E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401189541 | NA | 3.17E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401189541 | NA | 2.66E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401189541 | 1.19E-07 | NA | mr1565_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401189541 | 4.60E-09 | 2.95E-16 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401189541 | NA | 1.66E-08 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |