| Variant ID: vg0401160495 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1160495 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGAAATAGAATGATAGTCTTGCAATTTACACAGACGGTTGTGTGTTCTATGAGCTGATCCATGCCTTTGCATGTTCTCAAATTTCTATCATGGCCTAAA[C/T]
AATTTGACAAAAACAATGGATTTATAATTATCTACTAGGGTTTAAATATTTAATTTTCTCAGTTACACAAACGGGTTAACTAGAAGGCGTGCTACATGGC
GCCATGTAGCACGCCTTCTAGTTAACCCGTTTGTGTAACTGAGAAAATTAAATATTTAAACCCTAGTAGATAATTATAAATCCATTGTTTTTGTCAAATT[G/A]
TTTAGGCCATGATAGAAATTTGAGAACATGCAAAGGCATGGATCAGCTCATAGAACACACAACCGTCTGTGTAAATTGCAAGACTATCATTCTATTTCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 12.70% | 0.04% | 0.38% | NA |
| All Indica | 2759 | 83.00% | 16.30% | 0.07% | 0.65% | NA |
| All Japonica | 1512 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.30% | 29.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.00% | 23.90% | 0.11% | 1.97% | NA |
| Indica Intermediate | 786 | 84.40% | 15.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401160495 | C -> DEL | N | N | silent_mutation | Average:75.463; most accessible tissue: Minghui63 root, score: 91.66 | N | N | N | N |
| vg0401160495 | C -> T | LOC_Os04g02920.1 | upstream_gene_variant ; 151.0bp to feature; MODIFIER | silent_mutation | Average:75.463; most accessible tissue: Minghui63 root, score: 91.66 | N | N | N | N |
| vg0401160495 | C -> T | LOC_Os04g02910-LOC_Os04g02920 | intergenic_region ; MODIFIER | silent_mutation | Average:75.463; most accessible tissue: Minghui63 root, score: 91.66 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401160495 | NA | 1.81E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | NA | 8.55E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | NA | 4.67E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | NA | 7.45E-10 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | NA | 3.77E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | NA | 4.10E-06 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | 6.37E-07 | NA | mr1878 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | 7.06E-06 | 1.09E-07 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | 9.35E-06 | NA | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401160495 | 4.03E-06 | NA | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |