\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401155869:

Variant ID: vg0401155869 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1155869
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAATCATCCCCCAACCATAAAACCGGATATCTGGCGTCCCCTAACTAACCAAAACTGGTCATAATAGGTCCCTCAGTGGTTTTAACCCCGTTTTTGTC[C/A,T]
TATGTGGCGGCTGACTCAGCGTGGGACTCACGTGGACCCCACGTGTCAGGCTGCCACATCAGCACATACTCTATTTCCCCCTCTTCTCTCTCTGTCTCTG

Reverse complement sequence

CAGAGACAGAGAGAGAAGAGGGGGAAATAGAGTATGTGCTGATGTGGCAGCCTGACACGTGGGGTCCACGTGAGTCCCACGCTGAGTCAGCCGCCACATA[G/T,A]
GACAAAAACGGGGTTAAAACCACTGAGGGACCTATTATGACCAGTTTTGGTTAGTTAGGGGACGCCAGATATCCGGTTTTATGGTTGGGGGATGATTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 15.50% 2.22% 10.60% T: 2.05%
All Indica  2759 68.00% 15.00% 3.19% 10.29% T: 3.52%
All Japonica  1512 81.60% 3.70% 1.06% 13.62% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 52.30% 15.30% 3.03% 29.24% T: 0.17%
Indica II  465 87.50% 1.30% 3.01% 4.09% T: 4.09%
Indica III  913 66.70% 21.40% 2.08% 2.85% T: 7.01%
Indica Intermediate  786 69.80% 15.50% 4.71% 8.27% T: 1.65%
Temperate Japonica  767 97.10% 0.10% 0.39% 2.35% NA
Tropical Japonica  504 63.30% 9.90% 1.79% 25.00% NA
Japonica Intermediate  241 70.50% 2.10% 1.66% 25.73% NA
VI/Aromatic  96 85.40% 10.40% 0.00% 4.17% NA
Intermediate  90 74.40% 16.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401155869 C -> DEL N N silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> A LOC_Os04g02910.1 upstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> A LOC_Os04g02920.1 upstream_gene_variant ; 4777.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> A LOC_Os04g02910.3 upstream_gene_variant ; 4442.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> A LOC_Os04g02910.4 upstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> A LOC_Os04g02910-LOC_Os04g02920 intergenic_region ; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> T LOC_Os04g02910.1 upstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> T LOC_Os04g02920.1 upstream_gene_variant ; 4777.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> T LOC_Os04g02910.3 upstream_gene_variant ; 4442.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> T LOC_Os04g02910.4 upstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N
vg0401155869 C -> T LOC_Os04g02910-LOC_Os04g02920 intergenic_region ; MODIFIER silent_mutation Average:82.93; most accessible tissue: Minghui63 panicle, score: 94.477 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401155869 C A -0.11 -0.06 -0.06 -0.08 -0.09 -0.07
vg0401155869 C T 0.0 0.02 0.01 0.0 0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401155869 NA 1.38E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 7.34E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 5.00E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 9.20E-11 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 2.43E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 2.75E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 4.57E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 3.91E-07 1.67E-08 mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 1.52E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 7.83E-06 NA mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 2.17E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 1.22E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 8.35E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 8.88E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 6.21E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401155869 NA 5.69E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251