\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401153559:

Variant ID: vg0401153559 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1153559
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGTGTATTTAGAGCAAGTTTAATAGTATAGCCAACTAATAGCTCTAATTTATCTATAGCTAATCTAATAGCTCATTTATACAATAGATACATACTACA[C/T]
TATTAATACTTGGTCCCACTAGTCATACACACATTGTGTCTTGGAGTCCGTGCTACAGCTGACTATAAATCTGTAGCCTGCTGCTCTTTTCTCTCCTCAT

Reverse complement sequence

ATGAGGAGAGAAAAGAGCAGCAGGCTACAGATTTATAGTCAGCTGTAGCACGGACTCCAAGACACAATGTGTGTATGACTAGTGGGACCAAGTATTAATA[G/A]
TGTAGTATGTATCTATTGTATAAATGAGCTATTAGATTAGCTATAGATAAATTAGAGCTATTAGTTGGCTATACTATTAAACTTGCTCTAAATACACTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 46.20% 0.13% 0.00% NA
All Indica  2759 57.90% 42.10% 0.00% 0.00% NA
All Japonica  1512 40.30% 59.50% 0.26% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 24.50% 75.50% 0.00% 0.00% NA
Indica II  465 73.30% 26.70% 0.00% 0.00% NA
Indica III  913 64.50% 35.50% 0.00% 0.00% NA
Indica Intermediate  786 66.40% 33.60% 0.00% 0.00% NA
Temperate Japonica  767 10.00% 89.60% 0.39% 0.00% NA
Tropical Japonica  504 78.20% 21.80% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.30% 0.41% 0.00% NA
VI/Aromatic  96 17.70% 81.20% 1.04% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401153559 C -> T LOC_Os04g02910.1 upstream_gene_variant ; 1340.0bp to feature; MODIFIER silent_mutation Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541 N N N N
vg0401153559 C -> T LOC_Os04g02910.3 upstream_gene_variant ; 2132.0bp to feature; MODIFIER silent_mutation Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541 N N N N
vg0401153559 C -> T LOC_Os04g02910.4 upstream_gene_variant ; 1340.0bp to feature; MODIFIER silent_mutation Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541 N N N N
vg0401153559 C -> T LOC_Os04g02910-LOC_Os04g02920 intergenic_region ; MODIFIER silent_mutation Average:78.394; most accessible tissue: Minghui63 young leaf, score: 90.541 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401153559 C T 0.0 -0.03 -0.03 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401153559 NA 8.89E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 3.04E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 5.62E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 9.49E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 6.65E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 1.63E-08 6.78E-09 mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 8.41E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 8.66E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 3.32E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 3.99E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 5.49E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 8.87E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401153559 NA 1.66E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251