Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401127787:

Variant ID: vg0401127787 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1127787
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.39, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CTACCAATTAAGAAAAACCCACATGACTGAAAACACTACATATGTTACATATGTTAGTCTTGGCTTTTACACATTTGGGTTTTAATGTACTTGAAATAAA[T/C]
CAAAAGTGCCTTATTTTTTTTTCTTTTTTTTTTTTGGCCCAAACCTCTTCTCAGTCAATTTCACAGTCAAATTTGTTGGCCTACCCACGGAAGGACGATG

Reverse complement sequence

CATCGTCCTTCCGTGGGTAGGCCAACAAATTTGACTGTGAAATTGACTGAGAAGAGGTTTGGGCCAAAAAAAAAAAAGAAAAAAAAATAAGGCACTTTTG[A/G]
TTTATTTCAAGTACATTAAAACCCAAATGTGTAAAAGCCAAGACTAACATATGTAACATATGTAGTGTTTTCAGTCATGTGGGTTTTTCTTAATTGGTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	43.30%	0.55%	6.22%	NA
All Indica	2759	36.70%	52.60%	0.76%	9.97%	NA
All Japonica	1512	84.90%	13.80%	0.26%	1.12%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	67.70%	30.40%	0.00%	1.85%	NA
Indica II	465	28.40%	54.60%	0.86%	16.13%	NA
Indica III	913	22.80%	61.60%	0.99%	14.68%	NA
Indica Intermediate	786	34.20%	57.80%	1.02%	7.00%	NA
Temperate Japonica	767	90.40%	9.30%	0.39%	0.00%	NA
Tropical Japonica	504	81.50%	15.30%	0.00%	3.17%	NA
Japonica Intermediate	241	74.30%	24.90%	0.41%	0.41%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	41.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401127787	T -> C	LOC_Os04g02870.1	upstream_gene_variant ; 2774.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02890.1	upstream_gene_variant ; 926.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02870.2	upstream_gene_variant ; 2864.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02870.3	upstream_gene_variant ; 2787.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02870.4	upstream_gene_variant ; 2777.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02890.2	upstream_gene_variant ; 924.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02880.1	downstream_gene_variant ; 1056.0bp to feature; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> C	LOC_Os04g02880-LOC_Os04g02890	intergenic_region ; MODIFIER	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N
vg0401127787	T -> DEL	N	N	silent_mutation	Average:49.967; most accessible tissue: Callus, score: 87.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401127787	NA	4.14E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0401127787	3.10E-06	NA	mr1719	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401127787	NA	3.39E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401127787	NA	3.53E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401127787	1.22E-06	1.22E-06	mr1744_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251