\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401118008:

Variant ID: vg0401118008 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1118008
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGAACAATTGGCTAAGTTAACACAGCTGAGATCGCTGAAGCTGTCAGACGTTAAAAGTACTCACTATGCCAAGCTATTTGTATCCATCAGCAAGATGCGT[C/T]
TTCTACAGAGCCTGCTAATTGAGACTGCCAATAGGGATGAGTGTGTGAGCTTGGAAGCCCTGAACCCTGCACCTCATCACCTTGAACTACTCTTTATGAA

Reverse complement sequence

TTCATAAAGAGTAGTTCAAGGTGATGAGGTGCAGGGTTCAGGGCTTCCAAGCTCACACACTCATCCCTATTGGCAGTCTCAATTAGCAGGCTCTGTAGAA[G/A]
ACGCATCTTGCTGATGGATACAAATAGCTTGGCATAGTGAGTACTTTTAACGTCTGACAGCTTCAGCGATCTCAGCTGTGTTAACTTAGCCAATTGTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 29.50% 0.36% 0.36% NA
All Indica  2759 61.40% 38.10% 0.14% 0.36% NA
All Japonica  1512 87.70% 11.40% 0.73% 0.20% NA
Aus  269 67.30% 32.00% 0.37% 0.37% NA
Indica I  595 19.70% 80.20% 0.17% 0.00% NA
Indica II  465 79.10% 20.20% 0.22% 0.43% NA
Indica III  913 69.30% 30.10% 0.11% 0.44% NA
Indica Intermediate  786 73.40% 26.00% 0.13% 0.51% NA
Temperate Japonica  767 91.00% 7.80% 1.17% 0.00% NA
Tropical Japonica  504 87.50% 12.10% 0.00% 0.40% NA
Japonica Intermediate  241 77.60% 21.20% 0.83% 0.41% NA
VI/Aromatic  96 25.00% 74.00% 0.00% 1.04% NA
Intermediate  90 80.00% 16.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401118008 C -> DEL LOC_Os04g02860.1 N frameshift_variant Average:77.978; most accessible tissue: Zhenshan97 root, score: 84.776 N N N N
vg0401118008 C -> T LOC_Os04g02860.1 missense_variant ; p.Leu773Phe; MODERATE nonsynonymous_codon ; L773F Average:77.978; most accessible tissue: Zhenshan97 root, score: 84.776 unknown unknown TOLERATED 0.16

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401118008 C T 0.06 0.0 -0.01 -0.02 0.02 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401118008 7.31E-08 9.04E-17 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 5.77E-08 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 8.31E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 2.70E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 4.30E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 5.55E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 3.80E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 3.36E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 1.83E-08 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 1.38E-07 9.96E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 4.28E-09 4.27E-20 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 5.61E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401118008 NA 3.80E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251