Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401117842:

Variant ID: vg0401117842 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 1117842
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGCGTAACCAGGCTAAGGTTGCTACGCCATCTGATTGCAGGCAAAGCTGAAGCTACTTATTTTGGCCTTGCCGATGTCTACTCAGGTGTGCAAATGCC[T/G]
AATGGAACATGGCAATCGCTGGACATAAATGTATTCACAGGCATTTCTGCAAGCAACAAGTTGGTGGAACAATTGGCTAAGTTAACACAGCTGAGATCGC

Reverse complement sequence

GCGATCTCAGCTGTGTTAACTTAGCCAATTGTTCCACCAACTTGTTGCTTGCAGAAATGCCTGTGAATACATTTATGTCCAGCGATTGCCATGTTCCATT[A/C]
GGCATTTGCACACCTGAGTAGACATCGGCAAGGCCAAAATAAGTAGCTTCAGCTTTGCCTGCAATCAGATGGCGTAGCAACCTTAGCCTGGTTACGCCGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	29.40%	0.42%	0.32%	NA
All Indica	2759	61.50%	37.90%	0.33%	0.29%	NA
All Japonica	1512	87.70%	11.40%	0.66%	0.26%	NA
Aus	269	67.30%	32.00%	0.37%	0.37%	NA
Indica I	595	19.80%	79.70%	0.50%	0.00%	NA
Indica II	465	79.10%	20.00%	0.43%	0.43%	NA
Indica III	913	69.20%	30.20%	0.22%	0.33%	NA
Indica Intermediate	786	73.70%	25.70%	0.25%	0.38%	NA
Temperate Japonica	767	91.00%	7.80%	1.17%	0.00%	NA
Tropical Japonica	504	87.50%	12.10%	0.00%	0.40%	NA
Japonica Intermediate	241	77.60%	21.20%	0.41%	0.83%	NA
VI/Aromatic	96	25.00%	74.00%	0.00%	1.04%	NA
Intermediate	90	82.20%	16.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0401117842	T -> DEL	LOC_Os04g02860.1	N	frameshift_variant	Average:63.593; most accessible tissue: Zhenshan97 flower, score: 76.324	N	N	N	N
vg0401117842	T -> G	LOC_Os04g02860.1	synonymous_variant ; p.Pro717Pro; LOW	synonymous_codon	Average:63.593; most accessible tissue: Zhenshan97 flower, score: 76.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0401117842	2.53E-06	4.68E-15	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	2.68E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	4.51E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	1.02E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	2.57E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	2.16E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	1.93E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	2.08E-08	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	3.19E-06	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	2.41E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	1.07E-08	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	2.44E-08	2.63E-11	mr1565_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	2.27E-10	2.14E-21	mr1565_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	1.04E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	9.91E-07	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	3.35E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	NA	2.63E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0401117842	7.89E-06	NA	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251