\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0401020004:

Variant ID: vg0401020004 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 1020004
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CATCACATCAACCTGTCATACACACACAACTTTTCAGTCACATCATCTCCAATTTCAACCAAAATCCAAACTTTGGGCTGAACTAAACACAGCCATAATT[G/A]
CAATCAACTGCAAGTTAGGTTGAAAAAATTACTACTTAGGATACCTCTAAACAGTTTTCTTTGCTAGTTGAAACTTACCAACAGGTCACTATTAGCTCTC

Reverse complement sequence

GAGAGCTAATAGTGACCTGTTGGTAAGTTTCAACTAGCAAAGAAAACTGTTTAGAGGTATCCTAAGTAGTAATTTTTTCAACCTAACTTGCAGTTGATTG[C/T]
AATTATGGCTGTGTTTAGTTCAGCCCAAAGTTTGGATTTTGGTTGAAATTGGAGATGATGTGACTGAAAAGTTGTGTGTGTATGACAGGTTGATGTGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 34.20% 1.33% 9.04% NA
All Indica  2759 34.00% 48.70% 2.10% 15.19% NA
All Japonica  1512 89.60% 10.10% 0.20% 0.13% NA
Aus  269 75.10% 24.90% 0.00% 0.00% NA
Indica I  595 15.10% 81.80% 0.34% 2.69% NA
Indica II  465 26.00% 47.70% 1.72% 24.52% NA
Indica III  913 43.80% 32.00% 3.83% 20.37% NA
Indica Intermediate  786 41.60% 43.60% 1.65% 13.10% NA
Temperate Japonica  767 91.80% 8.10% 0.13% 0.00% NA
Tropical Japonica  504 82.50% 17.10% 0.20% 0.20% NA
Japonica Intermediate  241 97.10% 2.10% 0.41% 0.41% NA
VI/Aromatic  96 83.30% 15.60% 0.00% 1.04% NA
Intermediate  90 53.30% 38.90% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0401020004 G -> DEL N N silent_mutation Average:53.339; most accessible tissue: Zhenshan97 flower, score: 85.807 N N N N
vg0401020004 G -> A LOC_Os04g02680.1 upstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:53.339; most accessible tissue: Zhenshan97 flower, score: 85.807 N N N N
vg0401020004 G -> A LOC_Os04g02690.1 downstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:53.339; most accessible tissue: Zhenshan97 flower, score: 85.807 N N N N
vg0401020004 G -> A LOC_Os04g02680-LOC_Os04g02690 intergenic_region ; MODIFIER silent_mutation Average:53.339; most accessible tissue: Zhenshan97 flower, score: 85.807 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0401020004 G A -0.01 -0.01 -0.02 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0401020004 NA 1.43E-06 mr1450 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251