\
| Variant ID: vg0400999452 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 999452 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 200. )
GGGGAGGAGGACTGAGGCATTGCGGTGGCGACGACTATGGCGGCGAGGAGGACACACGGCAACTGAGCTGCAGGTGAGGAGGAGGTGGCGGCGGAGAGAA[T/C]
GAGGGTGAAGGAGAGAACGCGCGAGACTGAGAGGATAGGGGTGAAGTAGTGGCGCATGCGAACTGGGAAATTATTTTAATTCCTCGAGAGGATATTTCAT
ATGAAATATCCTCTCGAGGAATTAAAATAATTTCCCAGTTCGCATGCGCCACTACTTCACCCCTATCCTCTCAGTCTCGCGCGTTCTCTCCTTCACCCTC[A/G]
TTCTCTCCGCCGCCACCTCCTCCTCACCTGCAGCTCAGTTGCCGTGTGTCCTCCTCGCCGCCATAGTCGTCGCCACCGCAATGCCTCAGTCCTCCTCCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 5.80% | 0.34% | 0.13% | NA |
| All Indica | 2759 | 97.50% | 1.70% | 0.54% | 0.22% | NA |
| All Japonica | 1512 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.60% | 3.10% | 1.64% | 0.66% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 71.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400999452 | T -> C | LOC_Os04g02640.1 | downstream_gene_variant ; 312.0bp to feature; MODIFIER | silent_mutation | Average:64.083; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| vg0400999452 | T -> C | LOC_Os04g02650.1 | downstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:64.083; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| vg0400999452 | T -> C | LOC_Os04g02660.1 | downstream_gene_variant ; 4536.0bp to feature; MODIFIER | silent_mutation | Average:64.083; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| vg0400999452 | T -> C | LOC_Os04g02640-LOC_Os04g02650 | intergenic_region ; MODIFIER | silent_mutation | Average:64.083; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| vg0400999452 | T -> DEL | N | N | silent_mutation | Average:64.083; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400999452 | 2.62E-06 | 2.62E-06 | mr1281 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 3.78E-07 | 1.08E-09 | mr1343 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 2.55E-09 | 2.55E-09 | mr1343 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | NA | 3.87E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | NA | 9.96E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 5.49E-12 | 4.11E-17 | mr1829 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 6.89E-08 | 1.26E-11 | mr1829 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 1.78E-07 | NA | mr1842 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 3.38E-07 | 3.38E-07 | mr1842 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | NA | 3.33E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 1.88E-08 | 5.76E-10 | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 3.03E-06 | 1.35E-09 | mr1354_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 1.04E-13 | 4.37E-21 | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 7.44E-07 | 1.19E-11 | mr1829_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 1.21E-07 | 1.30E-17 | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | NA | 6.22E-07 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 2.30E-09 | 5.88E-19 | mr1902_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400999452 | 6.24E-06 | 1.49E-09 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |