\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400999452:

Variant ID: vg0400999452 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 999452
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGAGGAGGACTGAGGCATTGCGGTGGCGACGACTATGGCGGCGAGGAGGACACACGGCAACTGAGCTGCAGGTGAGGAGGAGGTGGCGGCGGAGAGAA[T/C]
GAGGGTGAAGGAGAGAACGCGCGAGACTGAGAGGATAGGGGTGAAGTAGTGGCGCATGCGAACTGGGAAATTATTTTAATTCCTCGAGAGGATATTTCAT

Reverse complement sequence

ATGAAATATCCTCTCGAGGAATTAAAATAATTTCCCAGTTCGCATGCGCCACTACTTCACCCCTATCCTCTCAGTCTCGCGCGTTCTCTCCTTCACCCTC[A/G]
TTCTCTCCGCCGCCACCTCCTCCTCACCTGCAGCTCAGTTGCCGTGTGTCCTCCTCGCCGCCATAGTCGTCGCCACCGCAATGCCTCAGTCCTCCTCCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 5.80% 0.34% 0.13% NA
All Indica  2759 97.50% 1.70% 0.54% 0.22% NA
All Japonica  1512 90.10% 9.90% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 94.60% 3.10% 1.64% 0.66% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 8.10% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 80.90% 19.10% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400999452 T -> C LOC_Os04g02640.1 downstream_gene_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:64.083; most accessible tissue: Callus, score: 87.267 N N N N
vg0400999452 T -> C LOC_Os04g02650.1 downstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:64.083; most accessible tissue: Callus, score: 87.267 N N N N
vg0400999452 T -> C LOC_Os04g02660.1 downstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:64.083; most accessible tissue: Callus, score: 87.267 N N N N
vg0400999452 T -> C LOC_Os04g02640-LOC_Os04g02650 intergenic_region ; MODIFIER silent_mutation Average:64.083; most accessible tissue: Callus, score: 87.267 N N N N
vg0400999452 T -> DEL N N silent_mutation Average:64.083; most accessible tissue: Callus, score: 87.267 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400999452 2.62E-06 2.62E-06 mr1281 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 3.78E-07 1.08E-09 mr1343 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 2.55E-09 2.55E-09 mr1343 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 NA 3.87E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 NA 9.96E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 5.49E-12 4.11E-17 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 6.89E-08 1.26E-11 mr1829 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 1.78E-07 NA mr1842 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 3.38E-07 3.38E-07 mr1842 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 NA 3.33E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 1.88E-08 5.76E-10 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 3.03E-06 1.35E-09 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 1.04E-13 4.37E-21 mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 7.44E-07 1.19E-11 mr1829_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 1.21E-07 1.30E-17 mr1842_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 NA 6.22E-07 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 2.30E-09 5.88E-19 mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452 6.24E-06 1.49E-09 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251