Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0400999452:

Variant ID: vg0400999452 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 999452
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGAGGAGGACTGAGGCATTGCGGTGGCGACGACTATGGCGGCGAGGAGGACACACGGCAACTGAGCTGCAGGTGAGGAGGAGGTGGCGGCGGAGAGAA[T/C]
GAGGGTGAAGGAGAGAACGCGCGAGACTGAGAGGATAGGGGTGAAGTAGTGGCGCATGCGAACTGGGAAATTATTTTAATTCCTCGAGAGGATATTTCAT

Reverse complement sequence

ATGAAATATCCTCTCGAGGAATTAAAATAATTTCCCAGTTCGCATGCGCCACTACTTCACCCCTATCCTCTCAGTCTCGCGCGTTCTCTCCTTCACCCTC[A/G]
TTCTCTCCGCCGCCACCTCCTCCTCACCTGCAGCTCAGTTGCCGTGTGTCCTCCTCGCCGCCATAGTCGTCGCCACCGCAATGCCTCAGTCCTCCTCCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	5.80%	0.34%	0.13%	NA
All Indica	2759	97.50%	1.70%	0.54%	0.22%	NA
All Japonica	1512	90.10%	9.90%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	94.60%	3.10%	1.64%	0.66%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	91.90%	8.10%	0.00%	0.00%	NA
Tropical Japonica	504	91.70%	8.30%	0.00%	0.00%	NA
Japonica Intermediate	241	80.90%	19.10%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	71.90%	1.04%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400999452	T -> C	LOC_Os04g02640.1	downstream_gene_variant ; 312.0bp to feature; MODIFIER	silent_mutation	Average:64.083; most accessible tissue: Callus, score: 87.267	N	N	N	N
vg0400999452	T -> C	LOC_Os04g02650.1	downstream_gene_variant ; 188.0bp to feature; MODIFIER	silent_mutation	Average:64.083; most accessible tissue: Callus, score: 87.267	N	N	N	N
vg0400999452	T -> C	LOC_Os04g02660.1	downstream_gene_variant ; 4536.0bp to feature; MODIFIER	silent_mutation	Average:64.083; most accessible tissue: Callus, score: 87.267	N	N	N	N
vg0400999452	T -> C	LOC_Os04g02640-LOC_Os04g02650	intergenic_region ; MODIFIER	silent_mutation	Average:64.083; most accessible tissue: Callus, score: 87.267	N	N	N	N
vg0400999452	T -> DEL	N	N	silent_mutation	Average:64.083; most accessible tissue: Callus, score: 87.267	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400999452	2.62E-06	2.62E-06	mr1281	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	3.78E-07	1.08E-09	mr1343	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	2.55E-09	2.55E-09	mr1343	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	NA	3.87E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	NA	9.96E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	5.49E-12	4.11E-17	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	6.89E-08	1.26E-11	mr1829	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	1.78E-07	NA	mr1842	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	3.38E-07	3.38E-07	mr1842	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	NA	3.33E-06	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	1.88E-08	5.76E-10	mr1354_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	3.03E-06	1.35E-09	mr1354_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	1.04E-13	4.37E-21	mr1829_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	7.44E-07	1.19E-11	mr1829_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	1.21E-07	1.30E-17	mr1842_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	NA	6.22E-07	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	2.30E-09	5.88E-19	mr1902_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400999452	6.24E-06	1.49E-09	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251