Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400998939:

Variant ID: vg0400998939 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 998939
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.16, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGCATGCAACACGTTTAATTAGTTATATATTACCACTATATATATATGTACTACCTCTGTCCCGTAACTTCCTCTGTTTCACAATGTTAGTCATTCTA[G/T]
CATTTCCCACATTCATATTAATGTTAATGAATCTAGATAGATATATATGTTTAGATTCATTAACATCAATATAAATGTGGGAAATGCTAGAATGACTTAC

Reverse complement sequence

GTAAGTCATTCTAGCATTTCCCACATTTATATTGATGTTAATGAATCTAAACATATATATCTATCTAGATTCATTAACATTAATATGAATGTGGGAAATG[C/A]
TAGAATGACTAACATTGTGAAACAGAGGAAGTTACGGGACAGAGGTAGTACATATATATATAGTGGTAATATATAACTAATTAAACGTGTTGCATGCAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	8.00%	0.87%	6.54%	NA
All Indica	2759	84.10%	3.80%	1.01%	11.05%	NA
All Japonica	1512	86.20%	13.50%	0.20%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.10%	0.50%	0.34%	2.02%	NA
Indica II	465	74.80%	2.60%	2.15%	20.43%	NA
Indica III	913	78.20%	6.00%	1.53%	14.24%	NA
Indica Intermediate	786	86.50%	4.60%	0.25%	8.65%	NA
Temperate Japonica	767	85.70%	14.10%	0.26%	0.00%	NA
Tropical Japonica	504	91.30%	8.70%	0.00%	0.00%	NA
Japonica Intermediate	241	77.60%	21.60%	0.41%	0.41%	NA
VI/Aromatic	96	29.20%	60.40%	10.42%	0.00%	NA
Intermediate	90	87.80%	8.90%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400998939	G -> DEL	N	N	silent_mutation	Average:57.23; most accessible tissue: Callus, score: 86.972	N	N	N	N
vg0400998939	G -> T	LOC_Os04g02640.1	3_prime_UTR_variant ; 285.0bp to feature; MODIFIER	silent_mutation	Average:57.23; most accessible tissue: Callus, score: 86.972	N	N	N	N
vg0400998939	G -> T	LOC_Os04g02650.1	downstream_gene_variant ; 701.0bp to feature; MODIFIER	silent_mutation	Average:57.23; most accessible tissue: Callus, score: 86.972	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400998939	1.54E-06	1.54E-06	mr1281	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	NA	1.26E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	1.30E-09	7.97E-14	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	7.60E-06	6.17E-09	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	5.46E-06	NA	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	4.13E-06	4.13E-06	mr1842	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	NA	2.48E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	2.00E-09	2.33E-15	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	3.28E-06	3.81E-10	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	NA	2.10E-06	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	9.25E-07	9.30E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939	4.82E-06	6.33E-09	mr1902_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251