\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400998939:

Variant ID: vg0400998939 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 998939
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.16, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGCATGCAACACGTTTAATTAGTTATATATTACCACTATATATATATGTACTACCTCTGTCCCGTAACTTCCTCTGTTTCACAATGTTAGTCATTCTA[G/T]
CATTTCCCACATTCATATTAATGTTAATGAATCTAGATAGATATATATGTTTAGATTCATTAACATCAATATAAATGTGGGAAATGCTAGAATGACTTAC

Reverse complement sequence

GTAAGTCATTCTAGCATTTCCCACATTTATATTGATGTTAATGAATCTAAACATATATATCTATCTAGATTCATTAACATTAATATGAATGTGGGAAATG[C/A]
TAGAATGACTAACATTGTGAAACAGAGGAAGTTACGGGACAGAGGTAGTACATATATATATAGTGGTAATATATAACTAATTAAACGTGTTGCATGCAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 8.00% 0.87% 6.54% NA
All Indica  2759 84.10% 3.80% 1.01% 11.05% NA
All Japonica  1512 86.20% 13.50% 0.20% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.10% 0.50% 0.34% 2.02% NA
Indica II  465 74.80% 2.60% 2.15% 20.43% NA
Indica III  913 78.20% 6.00% 1.53% 14.24% NA
Indica Intermediate  786 86.50% 4.60% 0.25% 8.65% NA
Temperate Japonica  767 85.70% 14.10% 0.26% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 77.60% 21.60% 0.41% 0.41% NA
VI/Aromatic  96 29.20% 60.40% 10.42% 0.00% NA
Intermediate  90 87.80% 8.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400998939 G -> DEL N N silent_mutation Average:57.23; most accessible tissue: Callus, score: 86.972 N N N N
vg0400998939 G -> T LOC_Os04g02640.1 3_prime_UTR_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:57.23; most accessible tissue: Callus, score: 86.972 N N N N
vg0400998939 G -> T LOC_Os04g02650.1 downstream_gene_variant ; 701.0bp to feature; MODIFIER silent_mutation Average:57.23; most accessible tissue: Callus, score: 86.972 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400998939 1.54E-06 1.54E-06 mr1281 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 NA 1.26E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 1.30E-09 7.97E-14 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 7.60E-06 6.17E-09 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 5.46E-06 NA mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 4.13E-06 4.13E-06 mr1842 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 NA 2.48E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 2.00E-09 2.33E-15 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 3.28E-06 3.81E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 NA 2.10E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 9.25E-07 9.30E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400998939 4.82E-06 6.33E-09 mr1902_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251