\
| Variant ID: vg0400958004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 958004 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
AATTTATCCGTTGTCCATGCATTAAGTGCAAAACCAGAGGGAGTATTCTGCAATAAGAATTATTCATATTCACTTGTTTGGGACGGGCTTCATGCCGAGC[G/A]
CTTGGACCTCACACCGGGAGCTAGGGGTTCAAATGGAAGAAGATAAAGCAGAAAACGAGAACATTCCGGACTGAGCTCAGTACGGTGGATTTGAAGTAAA
TTTACTTCAAATCCACCGTACTGAGCTCAGTCCGGAATGTTCTCGTTTTCTGCTTTATCTTCTTCCATTTGAACCCCTAGCTCCCGGTGTGAGGTCCAAG[C/T]
GCTCGGCATGAAGCCCGTCCCAAACAAGTGAATATGAATAATTCTTATTGCAGAATACTCCCTCTGGTTTTGCACTTAATGCATGGACAACGGATAAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 6.70% | 0.17% | 9.65% | NA |
| All Indica | 2759 | 77.50% | 6.30% | 0.22% | 15.98% | NA |
| All Japonica | 1512 | 90.50% | 9.30% | 0.07% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.40% | 1.70% | 0.00% | 9.92% | NA |
| Indica II | 465 | 66.50% | 0.90% | 0.22% | 32.47% | NA |
| Indica III | 913 | 81.40% | 12.00% | 0.33% | 6.24% | NA |
| Indica Intermediate | 786 | 71.10% | 6.50% | 0.25% | 22.14% | NA |
| Temperate Japonica | 767 | 83.40% | 16.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.60% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 83.30% | 4.40% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400958004 | G -> DEL | N | N | silent_mutation | Average:48.178; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| vg0400958004 | G -> A | LOC_Os04g02560.1 | downstream_gene_variant ; 1460.0bp to feature; MODIFIER | silent_mutation | Average:48.178; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| vg0400958004 | G -> A | LOC_Os04g02550-LOC_Os04g02560 | intergenic_region ; MODIFIER | silent_mutation | Average:48.178; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400958004 | NA | 1.52E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 1.98E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | 2.05E-06 | NA | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | 7.24E-06 | NA | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | 4.61E-06 | NA | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 6.18E-06 | mr1751 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 4.32E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | 1.90E-08 | 1.92E-09 | mr1928 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 4.59E-08 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 8.52E-08 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 1.31E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | 5.10E-06 | NA | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 2.68E-12 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 9.12E-07 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400958004 | NA | 8.11E-09 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |