\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400907136:

Variant ID: vg0400907136 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 907136
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAATAAAATCTTGTCTTAGGCTAAGTTCAGGTTTAATTTCTTCATGCATAACATATTATGGTATGCATGGCTACGAATGGAGAATAACTGAATTGGCA[A/T]
GGGATAGGAGATTTAAAGGGATGTTGGCGGTTCTTGCTTCTGTCGTGTTCTAGTTCTAGGTATTCTAGTTCTAGGCTTACGACCCCTCCTAGTACAACGG

Reverse complement sequence

CCGTTGTACTAGGAGGGGTCGTAAGCCTAGAACTAGAATACCTAGAACTAGAACACGACAGAAGCAAGAACCGCCAACATCCCTTTAAATCTCCTATCCC[T/A]
TGCCAATTCAGTTATTCTCCATTCGTAGCCATGCATACCATAATATGTTATGCATGAAGAAATTAAACCTGAACTTAGCCTAAGACAAGATTTTATTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 19.70% 0.08% 0.00% NA
All Indica  2759 67.30% 32.60% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 42.60% 57.40% 0.00% 0.00% NA
Indica III  913 68.00% 31.90% 0.11% 0.00% NA
Indica Intermediate  786 65.90% 33.80% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400907136 A -> T LOC_Os04g02500.5 upstream_gene_variant ; 419.0bp to feature; MODIFIER silent_mutation Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0400907136 A -> T LOC_Os04g02500.1 intron_variant ; MODIFIER silent_mutation Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0400907136 A -> T LOC_Os04g02500.2 intron_variant ; MODIFIER silent_mutation Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0400907136 A -> T LOC_Os04g02500.3 intron_variant ; MODIFIER silent_mutation Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0400907136 A -> T LOC_Os04g02500.4 intron_variant ; MODIFIER silent_mutation Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400907136 NA 1.98E-15 mr1565 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400907136 1.85E-06 5.66E-14 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400907136 NA 3.24E-14 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400907136 NA 3.57E-12 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251