\
| Variant ID: vg0400907136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 907136 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 291. )
TCTAATAAAATCTTGTCTTAGGCTAAGTTCAGGTTTAATTTCTTCATGCATAACATATTATGGTATGCATGGCTACGAATGGAGAATAACTGAATTGGCA[A/T]
GGGATAGGAGATTTAAAGGGATGTTGGCGGTTCTTGCTTCTGTCGTGTTCTAGTTCTAGGTATTCTAGTTCTAGGCTTACGACCCCTCCTAGTACAACGG
CCGTTGTACTAGGAGGGGTCGTAAGCCTAGAACTAGAATACCTAGAACTAGAACACGACAGAAGCAAGAACCGCCAACATCCCTTTAAATCTCCTATCCC[T/A]
TGCCAATTCAGTTATTCTCCATTCGTAGCCATGCATACCATAATATGTTATGCATGAAGAAATTAAACCTGAACTTAGCCTAAGACAAGATTTTATTAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.20% | 19.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 67.30% | 32.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 42.60% | 57.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.00% | 31.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 65.90% | 33.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400907136 | A -> T | LOC_Os04g02500.5 | upstream_gene_variant ; 419.0bp to feature; MODIFIER | silent_mutation | Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0400907136 | A -> T | LOC_Os04g02500.1 | intron_variant ; MODIFIER | silent_mutation | Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0400907136 | A -> T | LOC_Os04g02500.2 | intron_variant ; MODIFIER | silent_mutation | Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0400907136 | A -> T | LOC_Os04g02500.3 | intron_variant ; MODIFIER | silent_mutation | Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0400907136 | A -> T | LOC_Os04g02500.4 | intron_variant ; MODIFIER | silent_mutation | Average:75.764; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400907136 | NA | 1.98E-15 | mr1565 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400907136 | 1.85E-06 | 5.66E-14 | mr1565 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400907136 | NA | 3.24E-14 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400907136 | NA | 3.57E-12 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |