\
| Variant ID: vg0400871651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 871651 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAGGGCGCCTATCGAACGGTCAGAGCGCGACTGGCGAGGAGATCGGAAGGCTGCCGTTCGACAGGACCTGTCGAACAGCCCCCGTTCGACAGGCAGGGC[T/A]
GTCGAACTGCCCCTGTTCGACAGGATATCCGTCGAACTGGCACAGTTCGACAGGGTCGCGTTCTCCATTTATTTGTAATAAGTTATTTTTTTTAATAATT
AATTATTAAAAAAAATAACTTATTACAAATAAATGGAGAACGCGACCCTGTCGAACTGTGCCAGTTCGACGGATATCCTGTCGAACAGGGGCAGTTCGAC[A/T]
GCCCTGCCTGTCGAACGGGGGCTGTTCGACAGGTCCTGTCGAACGGCAGCCTTCCGATCTCCTCGCCAGTCGCGCTCTGACCGTTCGATAGGCGCCCTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 1.70% | 7.05% | 28.31% | NA |
| All Indica | 2759 | 72.10% | 0.70% | 2.54% | 24.68% | NA |
| All Japonica | 1512 | 44.40% | 1.50% | 12.83% | 41.34% | NA |
| Aus | 269 | 71.70% | 10.00% | 18.22% | 0.00% | NA |
| Indica I | 595 | 34.50% | 0.20% | 4.03% | 61.34% | NA |
| Indica II | 465 | 83.70% | 0.20% | 1.08% | 15.05% | NA |
| Indica III | 913 | 86.30% | 1.50% | 1.86% | 10.30% | NA |
| Indica Intermediate | 786 | 77.10% | 0.50% | 3.05% | 19.34% | NA |
| Temperate Japonica | 767 | 63.80% | 1.30% | 17.21% | 17.73% | NA |
| Tropical Japonica | 504 | 23.20% | 0.60% | 6.55% | 69.64% | NA |
| Japonica Intermediate | 241 | 27.00% | 3.70% | 12.03% | 57.26% | NA |
| VI/Aromatic | 96 | 58.30% | 10.40% | 15.62% | 15.62% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 5.56% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400871651 | T -> DEL | N | N | silent_mutation | Average:37.555; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0400871651 | T -> A | LOC_Os04g02410.1 | upstream_gene_variant ; 2872.0bp to feature; MODIFIER | silent_mutation | Average:37.555; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0400871651 | T -> A | LOC_Os04g02420.1 | downstream_gene_variant ; 411.0bp to feature; MODIFIER | silent_mutation | Average:37.555; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0400871651 | T -> A | LOC_Os04g02410-LOC_Os04g02420 | intergenic_region ; MODIFIER | silent_mutation | Average:37.555; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400871651 | 7.39E-12 | 7.39E-12 | mr1343 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | NA | 3.27E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | 1.66E-06 | 2.49E-07 | mr1415 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | NA | 3.34E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | 1.66E-06 | 2.49E-07 | mr1567 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | 2.65E-07 | 2.69E-11 | mr1829 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | 1.44E-06 | 1.44E-06 | mr1842 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | NA | 5.35E-07 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400871651 | NA | 2.31E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |