\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400867538:

Variant ID: vg0400867538 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 867538
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGTGAGGACCGGGATTATGTTCAGGGAAAAACAGAGGTCTAGTGCGGTCGGGATACCATGTGAGAAGATGACTAAAGTCAGGATTCTTGGAGGTCAA[C/T,G]
TTCGGTCAACGGTGGGGATCGGGACTAGACTCAGGGAGGAGTTGAGATCCAGACGGTCAAGGATACCGGGTGACGAAGTTGGATACAAGATGGCATACGG

Reverse complement sequence

CCGTATGCCATCTTGTATCCAACTTCGTCACCCGGTATCCTTGACCGTCTGGATCTCAACTCCTCCCTGAGTCTAGTCCCGATCCCCACCGTTGACCGAA[G/A,C]
TTGACCTCCAAGAATCCTGACTTTAGTCATCTTCTCACATGGTATCCCGACCGCACTAGACCTCTGTTTTTCCCTGAACATAATCCCGGTCCTCACCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 17.10% 0.66% 0.00% G: 0.17%
All Indica  2759 94.70% 5.30% 0.07% 0.00% NA
All Japonica  1512 73.70% 23.90% 1.79% 0.00% G: 0.53%
Aus  269 22.70% 76.60% 0.74% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 90.90% 8.90% 0.22% 0.00% NA
Indica Intermediate  786 94.10% 5.90% 0.00% 0.00% NA
Temperate Japonica  767 66.10% 33.90% 0.00% 0.00% NA
Tropical Japonica  504 85.50% 7.50% 5.36% 0.00% G: 1.59%
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400867538 C -> G LOC_Os04g02410.1 downstream_gene_variant ; 645.0bp to feature; MODIFIER silent_mutation Average:69.431; most accessible tissue: Minghui63 flag leaf, score: 87.725 N N N N
vg0400867538 C -> G LOC_Os04g02420.1 downstream_gene_variant ; 4524.0bp to feature; MODIFIER silent_mutation Average:69.431; most accessible tissue: Minghui63 flag leaf, score: 87.725 N N N N
vg0400867538 C -> G LOC_Os04g02400-LOC_Os04g02410 intergenic_region ; MODIFIER silent_mutation Average:69.431; most accessible tissue: Minghui63 flag leaf, score: 87.725 N N N N
vg0400867538 C -> T LOC_Os04g02410.1 downstream_gene_variant ; 645.0bp to feature; MODIFIER silent_mutation Average:69.431; most accessible tissue: Minghui63 flag leaf, score: 87.725 N N N N
vg0400867538 C -> T LOC_Os04g02420.1 downstream_gene_variant ; 4524.0bp to feature; MODIFIER silent_mutation Average:69.431; most accessible tissue: Minghui63 flag leaf, score: 87.725 N N N N
vg0400867538 C -> T LOC_Os04g02400-LOC_Os04g02410 intergenic_region ; MODIFIER silent_mutation Average:69.431; most accessible tissue: Minghui63 flag leaf, score: 87.725 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0400867538 C G -0.01 -0.01 0.0 0.0 -0.01 0.0
vg0400867538 C T -0.04 -0.02 -0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400867538 NA 1.62E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 3.57E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 5.43E-11 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 1.42E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 1.36E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 9.88E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 1.63E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 8.01E-06 8.00E-06 mr1587_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 3.22E-06 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 1.29E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 2.30E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 4.36E-06 mr1803_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 6.88E-08 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400867538 NA 1.21E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251