\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400814559:

Variant ID: vg0400814559 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 814559
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAAGTACATACTCTAATGACTAGCAAGCCATACAACTTTACAATATAAGGGAGTTCGTACTTATCTACTTATTACAACCAATACTGTTTGGCAAACT[T/A]
ATAGGATATCAATATACTGTTTCAAGCACACTGAGATAAGAGCAGCTTCATCTCCAAGTGGGACGCACCGAGATTATTGCAAATCTCCAAGTGGGTCCGT

Reverse complement sequence

ACGGACCCACTTGGAGATTTGCAATAATCTCGGTGCGTCCCACTTGGAGATGAAGCTGCTCTTATCTCAGTGTGCTTGAAACAGTATATTGATATCCTAT[A/T]
AGTTTGCCAAACAGTATTGGTTGTAATAAGTAGATAAGTACGAACTCCCTTATATTGTAAAGTTGTATGGCTTGCTAGTCATTAGAGTATGTACTTTTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 7.10% 0.23% 1.63% NA
All Indica  2759 96.20% 2.20% 0.36% 1.30% NA
All Japonica  1512 97.30% 0.10% 0.07% 2.51% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.00% 0.34% NA
Indica II  465 95.30% 0.90% 0.22% 3.66% NA
Indica III  913 95.00% 3.60% 0.66% 0.77% NA
Indica Intermediate  786 95.80% 2.50% 0.38% 1.27% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 93.50% 0.00% 0.20% 6.35% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 88.90% 7.80% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400814559 T -> DEL N N silent_mutation Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0400814559 T -> A LOC_Os04g02310.1 upstream_gene_variant ; 3017.0bp to feature; MODIFIER silent_mutation Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0400814559 T -> A LOC_Os04g02320.1 upstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0400814559 T -> A LOC_Os04g02330.1 downstream_gene_variant ; 74.0bp to feature; MODIFIER silent_mutation Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0400814559 T -> A LOC_Os04g02320-LOC_Os04g02330 intergenic_region ; MODIFIER silent_mutation Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400814559 NA 4.43E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 3.68E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 2.04E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 7.92E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 6.61E-40 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 6.50E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 2.24E-09 mr1735 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 6.16E-38 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 3.39E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 2.07E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 1.48E-14 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 2.06E-30 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400814559 NA 5.20E-28 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251