\
| Variant ID: vg0400814559 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 814559 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 277. )
TTAAAAGTACATACTCTAATGACTAGCAAGCCATACAACTTTACAATATAAGGGAGTTCGTACTTATCTACTTATTACAACCAATACTGTTTGGCAAACT[T/A]
ATAGGATATCAATATACTGTTTCAAGCACACTGAGATAAGAGCAGCTTCATCTCCAAGTGGGACGCACCGAGATTATTGCAAATCTCCAAGTGGGTCCGT
ACGGACCCACTTGGAGATTTGCAATAATCTCGGTGCGTCCCACTTGGAGATGAAGCTGCTCTTATCTCAGTGTGCTTGAAACAGTATATTGATATCCTAT[A/T]
AGTTTGCCAAACAGTATTGGTTGTAATAAGTAGATAAGTACGAACTCCCTTATATTGTAAAGTTGTATGGCTTGCTAGTCATTAGAGTATGTACTTTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 7.10% | 0.23% | 1.63% | NA |
| All Indica | 2759 | 96.20% | 2.20% | 0.36% | 1.30% | NA |
| All Japonica | 1512 | 97.30% | 0.10% | 0.07% | 2.51% | NA |
| Aus | 269 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.50% | 0.00% | 0.34% | NA |
| Indica II | 465 | 95.30% | 0.90% | 0.22% | 3.66% | NA |
| Indica III | 913 | 95.00% | 3.60% | 0.66% | 0.77% | NA |
| Indica Intermediate | 786 | 95.80% | 2.50% | 0.38% | 1.27% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 93.50% | 0.00% | 0.20% | 6.35% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400814559 | T -> DEL | N | N | silent_mutation | Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0400814559 | T -> A | LOC_Os04g02310.1 | upstream_gene_variant ; 3017.0bp to feature; MODIFIER | silent_mutation | Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0400814559 | T -> A | LOC_Os04g02320.1 | upstream_gene_variant ; 387.0bp to feature; MODIFIER | silent_mutation | Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0400814559 | T -> A | LOC_Os04g02330.1 | downstream_gene_variant ; 74.0bp to feature; MODIFIER | silent_mutation | Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0400814559 | T -> A | LOC_Os04g02320-LOC_Os04g02330 | intergenic_region ; MODIFIER | silent_mutation | Average:21.29; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400814559 | NA | 4.43E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 3.68E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 2.04E-14 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 7.92E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 6.61E-40 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 6.50E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 2.24E-09 | mr1735 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 6.16E-38 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 3.39E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 2.07E-20 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 1.48E-14 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 2.06E-30 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400814559 | NA | 5.20E-28 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |