\
| Variant ID: vg0400770969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 770969 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 250. )
AGATCGTCGGGGAGCTTCATCAGGATCGATAGGCCCCATCATCTTGATCAGGTTGTGTTGGAGCATATGAGATCCCGTCCGAGTGGTTTGAAGCCAACTT[A/G]
GATGAGATGATCTTGGAGTAGATCTCGGCCGAGTTCGGGAGACCGAACGGGGCGGAGACCTCGTCTCTTCCTGACTGGTTTGAATCCAAGTCAGGGAGAG
CTCTCCCTGACTTGGATTCAAACCAGTCAGGAAGAGACGAGGTCTCCGCCCCGTTCGGTCTCCCGAACTCGGCCGAGATCTACTCCAAGATCATCTCATC[T/C]
AAGTTGGCTTCAAACCACTCGGACGGGATCTCATATGCTCCAACACAACCTGATCAAGATGATGGGGCCTATCGATCCTGATGAAGCTCCCCGACGATCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 0.10% | 5.67% | 28.90% | NA |
| All Indica | 2759 | 43.40% | 0.10% | 9.46% | 47.01% | NA |
| All Japonica | 1512 | 96.60% | 0.00% | 0.20% | 3.17% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 18.80% | 0.00% | 4.54% | 76.64% | NA |
| Indica II | 465 | 44.50% | 0.00% | 3.23% | 52.26% | NA |
| Indica III | 913 | 56.50% | 0.30% | 17.09% | 26.07% | NA |
| Indica Intermediate | 786 | 46.10% | 0.10% | 8.02% | 45.80% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 90.90% | 0.00% | 0.40% | 8.73% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 2.22% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400770969 | A -> DEL | N | N | silent_mutation | Average:44.935; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0400770969 | A -> G | LOC_Os04g02230.1 | upstream_gene_variant ; 216.0bp to feature; MODIFIER | silent_mutation | Average:44.935; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0400770969 | A -> G | LOC_Os04g02240.1 | upstream_gene_variant ; 3810.0bp to feature; MODIFIER | silent_mutation | Average:44.935; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| vg0400770969 | A -> G | LOC_Os04g02230-LOC_Os04g02240 | intergenic_region ; MODIFIER | silent_mutation | Average:44.935; most accessible tissue: Minghui63 flag leaf, score: 77.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400770969 | 2.53E-06 | 6.56E-06 | mr1438 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400770969 | 1.46E-06 | 4.64E-07 | mr1438 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400770969 | 4.86E-06 | 4.86E-06 | mr1551 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400770969 | 5.25E-06 | NA | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |