Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400763214:

Variant ID: vg0400763214 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 763214
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.35, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTAACAATTGCCTTCCATCTTCCAAAGAAACACAACGTTGCAAAATTCCTGACGGACTCCACTTGTACAAATCATCCTCAATCATGACATAAAGCCTG[C/A]
TGTGTCGAGAGATCCGCTCGGCTCCATCTTTGTCTTGAGGTAACTCTTGTTTAGTCAAAAATTGTTGAAGGGCTCTCTCCAGTCGGCGTCAATCATGCTT

Reverse complement sequence

AAGCATGATTGACGCCGACTGGAGAGAGCCCTTCAACAATTTTTGACTAAACAAGAGTTACCTCAAGACAAAGATGGAGCCGAGCGGATCTCTCGACACA[G/T]
CAGGCTTTATGTCATGATTGAGGATGATTTGTACAAGTGGAGTCCGTCAGGAATTTTGCAACGTTGTGTTTCTTTGGAAGATGGAAGGCAATTGTTACAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.90%	26.90%	4.15%	41.01%	NA
All Indica	2759	24.00%	11.00%	6.63%	58.35%	NA
All Japonica	1512	40.50%	39.10%	0.60%	19.84%	NA
Aus	269	3.70%	94.10%	1.49%	0.74%	NA
Indica I	595	6.90%	6.10%	4.87%	82.18%	NA
Indica II	465	24.50%	9.20%	6.02%	60.22%	NA
Indica III	913	32.20%	15.70%	8.98%	43.15%	NA
Indica Intermediate	786	27.20%	10.30%	5.60%	56.87%	NA
Temperate Japonica	767	14.90%	62.50%	0.52%	22.16%	NA
Tropical Japonica	504	69.60%	12.70%	0.79%	16.87%	NA
Japonica Intermediate	241	61.00%	19.90%	0.41%	18.67%	NA
VI/Aromatic	96	4.20%	94.80%	0.00%	1.04%	NA
Intermediate	90	33.30%	38.90%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400763214	C -> DEL	N	N	silent_mutation	Average:22.734; most accessible tissue: Callus, score: 61.745	N	N	N	N
vg0400763214	C -> A	LOC_Os04g02210.1	upstream_gene_variant ; 3529.0bp to feature; MODIFIER	silent_mutation	Average:22.734; most accessible tissue: Callus, score: 61.745	N	N	N	N
vg0400763214	C -> A	LOC_Os04g02200.1	downstream_gene_variant ; 4628.0bp to feature; MODIFIER	silent_mutation	Average:22.734; most accessible tissue: Callus, score: 61.745	N	N	N	N
vg0400763214	C -> A	LOC_Os04g02230.1	downstream_gene_variant ; 1054.0bp to feature; MODIFIER	silent_mutation	Average:22.734; most accessible tissue: Callus, score: 61.745	N	N	N	N
vg0400763214	C -> A	LOC_Os04g02220.1	intron_variant ; MODIFIER	silent_mutation	Average:22.734; most accessible tissue: Callus, score: 61.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400763214	NA	2.46E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214	NA	5.33E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214	NA	2.41E-10	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214	5.75E-06	NA	mr1448_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214	NA	1.18E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251