\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400763214:

Variant ID: vg0400763214 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 763214
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.35, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAACAATTGCCTTCCATCTTCCAAAGAAACACAACGTTGCAAAATTCCTGACGGACTCCACTTGTACAAATCATCCTCAATCATGACATAAAGCCTG[C/A]
TGTGTCGAGAGATCCGCTCGGCTCCATCTTTGTCTTGAGGTAACTCTTGTTTAGTCAAAAATTGTTGAAGGGCTCTCTCCAGTCGGCGTCAATCATGCTT

Reverse complement sequence

AAGCATGATTGACGCCGACTGGAGAGAGCCCTTCAACAATTTTTGACTAAACAAGAGTTACCTCAAGACAAAGATGGAGCCGAGCGGATCTCTCGACACA[G/T]
CAGGCTTTATGTCATGATTGAGGATGATTTGTACAAGTGGAGTCCGTCAGGAATTTTGCAACGTTGTGTTTCTTTGGAAGATGGAAGGCAATTGTTACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.90% 26.90% 4.15% 41.01% NA
All Indica  2759 24.00% 11.00% 6.63% 58.35% NA
All Japonica  1512 40.50% 39.10% 0.60% 19.84% NA
Aus  269 3.70% 94.10% 1.49% 0.74% NA
Indica I  595 6.90% 6.10% 4.87% 82.18% NA
Indica II  465 24.50% 9.20% 6.02% 60.22% NA
Indica III  913 32.20% 15.70% 8.98% 43.15% NA
Indica Intermediate  786 27.20% 10.30% 5.60% 56.87% NA
Temperate Japonica  767 14.90% 62.50% 0.52% 22.16% NA
Tropical Japonica  504 69.60% 12.70% 0.79% 16.87% NA
Japonica Intermediate  241 61.00% 19.90% 0.41% 18.67% NA
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 33.30% 38.90% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400763214 C -> DEL N N silent_mutation Average:22.734; most accessible tissue: Callus, score: 61.745 N N N N
vg0400763214 C -> A LOC_Os04g02210.1 upstream_gene_variant ; 3529.0bp to feature; MODIFIER silent_mutation Average:22.734; most accessible tissue: Callus, score: 61.745 N N N N
vg0400763214 C -> A LOC_Os04g02200.1 downstream_gene_variant ; 4628.0bp to feature; MODIFIER silent_mutation Average:22.734; most accessible tissue: Callus, score: 61.745 N N N N
vg0400763214 C -> A LOC_Os04g02230.1 downstream_gene_variant ; 1054.0bp to feature; MODIFIER silent_mutation Average:22.734; most accessible tissue: Callus, score: 61.745 N N N N
vg0400763214 C -> A LOC_Os04g02220.1 intron_variant ; MODIFIER silent_mutation Average:22.734; most accessible tissue: Callus, score: 61.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400763214 NA 2.46E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214 NA 5.33E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214 NA 2.41E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214 5.75E-06 NA mr1448_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400763214 NA 1.18E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251