\
| Variant ID: vg0400690241 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 690241 |
| Reference Allele: A | Alternative Allele: G,ATAG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )
GTCTAAACTACCAGATACTACTCTAAAATCATCATCATGACATAGAGTAATTGCATAAGCAAATACTATACCCGCACCAAAGCATCTCCCAGATAAGCTA[A/G,ATAG]
CCGTATATTCAGTATAACATGAACATAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCAATACCATAAATGTATTTAGAAGAGTATTCTAATAA
TTATTAGAATACTCTTCTAAATACATTTATGGTATTGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTATGTTCATGTTATACTGAATATACGG[T/C,CTAT]
TAGCTTATCTGGGAGATGCTTTGGTGCGGGTATAGTATTTGCTTATGCAATTACTCTATGTCATGATGATGATTTTAGAGTAGTATCTGGTAGTTTAGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 14.30% | 2.03% | 0.00% | ATAG: 0.02% |
| All Indica | 2759 | 95.70% | 1.60% | 2.61% | 0.00% | ATAG: 0.04% |
| All Japonica | 1512 | 60.30% | 38.20% | 1.46% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 87.70% | 3.40% | 8.60% | 0.00% | ATAG: 0.22% |
| Indica III | 913 | 97.40% | 1.10% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 1.80% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.90% | 8.70% | 4.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 15.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400690241 | A -> G | LOC_Os04g02110.1 | upstream_gene_variant ; 2525.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> G | LOC_Os04g02110.3 | upstream_gene_variant ; 2525.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> G | LOC_Os04g02110.2 | upstream_gene_variant ; 2525.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> G | LOC_Os04g02120.1 | downstream_gene_variant ; 2519.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> G | LOC_Os04g02110-LOC_Os04g02120 | intergenic_region ; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> ATAG | LOC_Os04g02110.1 | upstream_gene_variant ; 2526.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> ATAG | LOC_Os04g02110.3 | upstream_gene_variant ; 2526.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> ATAG | LOC_Os04g02110.2 | upstream_gene_variant ; 2526.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> ATAG | LOC_Os04g02120.1 | downstream_gene_variant ; 2518.0bp to feature; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0400690241 | A -> ATAG | LOC_Os04g02110-LOC_Os04g02120 | intergenic_region ; MODIFIER | silent_mutation | Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400690241 | NA | 6.21E-07 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | NA | 2.45E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | NA | 1.16E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | NA | 5.75E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | 3.41E-06 | NA | mr1499_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | NA | 1.96E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | NA | 1.96E-07 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400690241 | NA | 7.31E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |