\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400690241:

Variant ID: vg0400690241 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 690241
Reference Allele: AAlternative Allele: G,ATAG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTAAACTACCAGATACTACTCTAAAATCATCATCATGACATAGAGTAATTGCATAAGCAAATACTATACCCGCACCAAAGCATCTCCCAGATAAGCTA[A/G,ATAG]
CCGTATATTCAGTATAACATGAACATAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCAATACCATAAATGTATTTAGAAGAGTATTCTAATAA

Reverse complement sequence

TTATTAGAATACTCTTCTAAATACATTTATGGTATTGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTATGTTCATGTTATACTGAATATACGG[T/C,CTAT]
TAGCTTATCTGGGAGATGCTTTGGTGCGGGTATAGTATTTGCTTATGCAATTACTCTATGTCATGATGATGATTTTAGAGTAGTATCTGGTAGTTTAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 14.30% 2.03% 0.00% ATAG: 0.02%
All Indica  2759 95.70% 1.60% 2.61% 0.00% ATAG: 0.04%
All Japonica  1512 60.30% 38.20% 1.46% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 87.70% 3.40% 8.60% 0.00% ATAG: 0.22%
Indica III  913 97.40% 1.10% 1.53% 0.00% NA
Indica Intermediate  786 96.10% 1.80% 2.16% 0.00% NA
Temperate Japonica  767 35.70% 64.30% 0.00% 0.00% NA
Tropical Japonica  504 86.90% 8.70% 4.37% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400690241 A -> G LOC_Os04g02110.1 upstream_gene_variant ; 2525.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> G LOC_Os04g02110.3 upstream_gene_variant ; 2525.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> G LOC_Os04g02110.2 upstream_gene_variant ; 2525.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> G LOC_Os04g02120.1 downstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> G LOC_Os04g02110-LOC_Os04g02120 intergenic_region ; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> ATAG LOC_Os04g02110.1 upstream_gene_variant ; 2526.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> ATAG LOC_Os04g02110.3 upstream_gene_variant ; 2526.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> ATAG LOC_Os04g02110.2 upstream_gene_variant ; 2526.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> ATAG LOC_Os04g02120.1 downstream_gene_variant ; 2518.0bp to feature; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N
vg0400690241 A -> ATAG LOC_Os04g02110-LOC_Os04g02120 intergenic_region ; MODIFIER silent_mutation Average:52.081; most accessible tissue: Minghui63 flag leaf, score: 81.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400690241 NA 6.21E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 NA 2.45E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 NA 1.16E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 NA 5.75E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 3.41E-06 NA mr1499_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 NA 1.96E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 NA 1.96E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690241 NA 7.31E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251