\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400690170:

Variant ID: vg0400690170 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 690170
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.28, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


ACCATCAGCGGCCCACCTCTCATCCGCAATATATAACCCCAAATAATGATATCCCGTAATCTAGACACCACGTCTAAACTACCAGATACTACTCTAAAAT[C/T,G]
ATCATCATGACATAGAGTAATTGCATAAGCAAATACTATACCCGCACCAAAGCATCTCCCAGATAAGCTAACCGTATATTCAGTATAACATGAACATAAT

Reverse complement sequence

ATTATGTTCATGTTATACTGAATATACGGTTAGCTTATCTGGGAGATGCTTTGGTGCGGGTATAGTATTTGCTTATGCAATTACTCTATGTCATGATGAT[G/A,C]
ATTTTAGAGTAGTATCTGGTAGTTTAGACGTGGTGTCTAGATTACGGGATATCATTATTTGGGGTTATATATTGCGGATGAGAGGTGGGCCGCTGATGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 31.40% 2.14% 0.00% G: 0.02%
All Indica  2759 75.40% 21.80% 2.83% 0.00% NA
All Japonica  1512 44.80% 53.80% 1.39% 0.00% G: 0.07%
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 91.90% 8.10% 0.00% 0.00% NA
Indica II  465 63.20% 27.50% 9.25% 0.00% NA
Indica III  913 69.30% 28.90% 1.75% 0.00% NA
Indica Intermediate  786 77.00% 20.60% 2.42% 0.00% NA
Temperate Japonica  767 11.30% 88.70% 0.00% 0.00% NA
Tropical Japonica  504 86.10% 9.70% 3.97% 0.00% G: 0.20%
Japonica Intermediate  241 64.70% 34.90% 0.41% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400690170 C -> G LOC_Os04g02110.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> G LOC_Os04g02110.3 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> G LOC_Os04g02110.2 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> G LOC_Os04g02120.1 downstream_gene_variant ; 2590.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> G LOC_Os04g02110-LOC_Os04g02120 intergenic_region ; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> T LOC_Os04g02110.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> T LOC_Os04g02110.3 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> T LOC_Os04g02110.2 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> T LOC_Os04g02120.1 downstream_gene_variant ; 2590.0bp to feature; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0400690170 C -> T LOC_Os04g02110-LOC_Os04g02120 intergenic_region ; MODIFIER silent_mutation Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400690170 NA 2.37E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 7.70E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 7.56E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 8.76E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 5.92E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 4.72E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.02E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 7.92E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.25E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 5.18E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.28E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 6.00E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.34E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.84E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.12E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 4.33E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.10E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.39E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.01E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.09E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 3.44E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 7.69E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 1.24E-07 NA mr1565_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 4.66E-06 NA mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 3.78E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 3.72E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.99E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.21E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.13E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.98E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 7.63E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 6.20E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.53E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 6.63E-08 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.03E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.40E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 2.81E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 6.17E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 4.25E-09 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 4.77E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 1.14E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170 NA 4.22E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251