Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400690170:

Variant ID: vg0400690170 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 690170
Reference Allele: C	Alternative Allele: T,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.28, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

ACCATCAGCGGCCCACCTCTCATCCGCAATATATAACCCCAAATAATGATATCCCGTAATCTAGACACCACGTCTAAACTACCAGATACTACTCTAAAAT[C/T,G]
ATCATCATGACATAGAGTAATTGCATAAGCAAATACTATACCCGCACCAAAGCATCTCCCAGATAAGCTAACCGTATATTCAGTATAACATGAACATAAT

Reverse complement sequence

ATTATGTTCATGTTATACTGAATATACGGTTAGCTTATCTGGGAGATGCTTTGGTGCGGGTATAGTATTTGCTTATGCAATTACTCTATGTCATGATGAT[G/A,C]
ATTTTAGAGTAGTATCTGGTAGTTTAGACGTGGTGTCTAGATTACGGGATATCATTATTTGGGGTTATATATTGCGGATGAGAGGTGGGCCGCTGATGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	31.40%	2.14%	0.00%	G: 0.02%
All Indica	2759	75.40%	21.80%	2.83%	0.00%	NA
All Japonica	1512	44.80%	53.80%	1.39%	0.00%	G: 0.07%
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	91.90%	8.10%	0.00%	0.00%	NA
Indica II	465	63.20%	27.50%	9.25%	0.00%	NA
Indica III	913	69.30%	28.90%	1.75%	0.00%	NA
Indica Intermediate	786	77.00%	20.60%	2.42%	0.00%	NA
Temperate Japonica	767	11.30%	88.70%	0.00%	0.00%	NA
Tropical Japonica	504	86.10%	9.70%	3.97%	0.00%	G: 0.20%
Japonica Intermediate	241	64.70%	34.90%	0.41%	0.00%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	66.70%	31.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400690170	C -> G	LOC_Os04g02110.1	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> G	LOC_Os04g02110.3	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> G	LOC_Os04g02110.2	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> G	LOC_Os04g02120.1	downstream_gene_variant ; 2590.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> G	LOC_Os04g02110-LOC_Os04g02120	intergenic_region ; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> T	LOC_Os04g02110.1	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> T	LOC_Os04g02110.3	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> T	LOC_Os04g02110.2	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> T	LOC_Os04g02120.1	downstream_gene_variant ; 2590.0bp to feature; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0400690170	C -> T	LOC_Os04g02110-LOC_Os04g02120	intergenic_region ; MODIFIER	silent_mutation	Average:49.531; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400690170	NA	2.37E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	7.70E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	7.56E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	8.76E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	5.92E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	4.72E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.02E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	7.92E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.25E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	5.18E-09	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.28E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	6.00E-06	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.34E-08	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.84E-07	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.12E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	4.33E-08	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.10E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.39E-08	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.01E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.09E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	3.44E-06	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	7.69E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	1.24E-07	NA	mr1565_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	4.66E-06	NA	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	3.78E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	3.72E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.99E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.21E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.13E-16	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.98E-06	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	7.63E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	6.20E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.53E-10	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	6.63E-08	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.03E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.40E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	2.81E-09	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	6.17E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	4.25E-09	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	4.77E-06	mr1887_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	1.14E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400690170	NA	4.22E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251