Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400652504:

Variant ID: vg0400652504 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 652504
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AGTATATTGTCAAAATAAGTACTTAAAAATTTGAATTTATATAAAAAATACTCCAAATAATTAAGTTGTCACATAACTTATTAATTTATTGTATCAAAAT[C/T]
GTATCTACCTTGCAAGTTGTTGCATTTATACGATCACTTATAAAGTTCTTATACTAAATTGCACCTTCTTGCCAAATTGTTGCACTAGAACGCTCATTTT

Reverse complement sequence

AAAATGAGCGTTCTAGTGCAACAATTTGGCAAGAAGGTGCAATTTAGTATAAGAACTTTATAAGTGATCGTATAAATGCAACAACTTGCAAGGTAGATAC[G/A]
ATTTTGATACAATAAATTAATAAGTTATGTGACAACTTAATTATTTGGAGTATTTTTTATATAAATTCAAATTTTTAAGTACTTATTTTGACAATATACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	0.20%	8.95%	15.28%	NA
All Indica	2759	78.10%	0.10%	10.91%	10.91%	NA
All Japonica	1512	67.40%	0.00%	7.47%	25.13%	NA
Aus	269	91.10%	2.20%	1.12%	5.58%	NA
Indica I	595	69.60%	0.00%	17.65%	12.77%	NA
Indica II	465	70.80%	0.00%	11.83%	17.42%	NA
Indica III	913	90.60%	0.10%	5.37%	3.94%	NA
Indica Intermediate	786	74.40%	0.10%	11.70%	13.74%	NA
Temperate Japonica	767	87.20%	0.00%	1.96%	10.82%	NA
Tropical Japonica	504	44.60%	0.00%	13.69%	41.67%	NA
Japonica Intermediate	241	51.90%	0.00%	12.03%	36.10%	NA
VI/Aromatic	96	94.80%	0.00%	2.08%	3.12%	NA
Intermediate	90	70.00%	0.00%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400652504	C -> DEL	N	N	silent_mutation	Average:48.746; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0400652504	C -> T	LOC_Os04g02050.1	upstream_gene_variant ; 2822.0bp to feature; MODIFIER	silent_mutation	Average:48.746; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0400652504	C -> T	LOC_Os04g02060.1	upstream_gene_variant ; 4967.0bp to feature; MODIFIER	silent_mutation	Average:48.746; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0400652504	C -> T	LOC_Os04g02050.2	upstream_gene_variant ; 2370.0bp to feature; MODIFIER	silent_mutation	Average:48.746; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0400652504	C -> T	LOC_Os04g02050-LOC_Os04g02060	intergenic_region ; MODIFIER	silent_mutation	Average:48.746; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400652504	NA	7.65E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	NA	5.72E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	NA	9.47E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	NA	2.45E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	NA	8.88E-06	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	NA	6.04E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	NA	1.46E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652504	7.07E-06	NA	mr1954_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251