\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400652453:

Variant ID: vg0400652453 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 652453
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATTAGTTATTAGGATAAAAATATAAATATGTTTATACAAATCCACGCTAGTATATTGTCAAAATAAGTACTTAAAAATTTGAATTTATATAAAAAAT[A/G]
CTCCAAATAATTAAGTTGTCACATAACTTATTAATTTATTGTATCAAAATCGTATCTACCTTGCAAGTTGTTGCATTTATACGATCACTTATAAAGTTCT

Reverse complement sequence

AGAACTTTATAAGTGATCGTATAAATGCAACAACTTGCAAGGTAGATACGATTTTGATACAATAAATTAATAAGTTATGTGACAACTTAATTATTTGGAG[T/C]
ATTTTTTATATAAATTCAAATTTTTAAGTACTTATTTTGACAATATACTAGCGTGGATTTGTATAAACATATTTATATTTTTATCCTAATAACTAATAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.40% 4.10% 17.90% 38.64% NA
All Indica  2759 26.30% 5.90% 24.97% 42.77% NA
All Japonica  1512 53.20% 0.70% 6.22% 39.88% NA
Aus  269 81.80% 3.70% 13.01% 1.49% NA
Indica I  595 11.10% 12.90% 15.13% 60.84% NA
Indica II  465 24.90% 3.40% 24.73% 46.88% NA
Indica III  913 37.10% 4.20% 33.30% 25.41% NA
Indica Intermediate  786 26.10% 4.20% 22.90% 46.82% NA
Temperate Japonica  767 85.90% 0.00% 0.52% 13.56% NA
Tropical Japonica  504 10.30% 1.80% 14.68% 73.21% NA
Japonica Intermediate  241 38.60% 0.80% 6.64% 53.94% NA
VI/Aromatic  96 83.30% 4.20% 7.29% 5.21% NA
Intermediate  90 35.60% 3.30% 23.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400652453 A -> DEL N N silent_mutation Average:20.41; most accessible tissue: Callus, score: 36.635 N N N N
vg0400652453 A -> G LOC_Os04g02050.1 upstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:20.41; most accessible tissue: Callus, score: 36.635 N N N N
vg0400652453 A -> G LOC_Os04g02050.2 upstream_gene_variant ; 2319.0bp to feature; MODIFIER silent_mutation Average:20.41; most accessible tissue: Callus, score: 36.635 N N N N
vg0400652453 A -> G LOC_Os04g02050-LOC_Os04g02060 intergenic_region ; MODIFIER silent_mutation Average:20.41; most accessible tissue: Callus, score: 36.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400652453 NA 2.80E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 2.60E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 7.41E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 6.89E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 3.78E-08 mr1161_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 3.97E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 4.61E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 1.19E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 1.97E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 1.37E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 1.36E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 7.38E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 8.80E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 8.90E-06 8.90E-06 mr1597_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 4.19E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 7.80E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 7.75E-06 1.25E-08 mr1739_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 2.30E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 3.42E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 1.15E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 5.73E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 4.93E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400652453 NA 9.21E-07 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251