Search for Variation information by Variation ID:
Detailed information for vg0400640863:
| Variant ID: vg0400640863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 640863 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.38, others allele: 0.00, population size: 32. )
Flanking Sequence (100 bp) in Reference Genome:
TCAGTGTGCCCGGGAGTCTTGGCATTCTTTTCAGTTTGGGAAAAACAACGAGTTTCAGCTGACGAAGGGAAACGAAAAGCTTGCCTATTTCTGGAAGATG[G/T]
TCGAGATTGTAACATCGACAGAGTTGGAGATCTTGCAGGTTCGTGAATATACCATTCTGATTTTCTGACGACAACCAACTTGGGCACCTCAGTCCATTGT
Reverse complement sequence
ACAATGGACTGAGGTGCCCAAGTTGGTTGTCGTCAGAAAATCAGAATGGTATATTCACGAACCTGCAAGATCTCCAACTCTGTCGATGTTACAATCTCGA[C/A]
CATCTTCCAGAAATAGGCAAGCTTTTCGTTTCCCTTCGTCAGCTGAAACTCGTTGTTTTTCCCAAACTGAAAAGAATGCCAAGACTCCCGGGCACACTGA
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.40% | 15.50% | 0.38% | 61.68% | NA |
| All Indica | 2759 | 27.40% | 1.30% | 0.47% | 70.86% | NA |
| All Japonica | 1512 | 13.60% | 45.20% | 0.20% | 41.01% | NA |
| Aus | 269 | 8.20% | 0.70% | 0.00% | 91.08% | NA |
| Indica I | 595 | 8.60% | 1.70% | 0.67% | 89.08% | NA |
| Indica II | 465 | 42.40% | 1.50% | 0.22% | 55.91% | NA |
| Indica III | 913 | 33.50% | 0.20% | 0.66% | 65.61% | NA |
| Indica Intermediate | 786 | 25.70% | 2.00% | 0.25% | 72.01% | NA |
| Temperate Japonica | 767 | 16.40% | 73.80% | 0.13% | 9.65% | NA |
| Tropical Japonica | 504 | 10.50% | 9.70% | 0.20% | 79.56% | NA |
| Japonica Intermediate | 241 | 10.80% | 28.60% | 0.41% | 60.17% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 0.00% | 43.75% | NA |
| Intermediate | 90 | 25.60% | 13.30% | 2.22% | 58.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400640863 | G -> DEL | LOC_Os04g02030.1 | N | frameshift_variant | Average:46.764; most accessible tissue: Minghui63 flower, score: 79.848 | N | N | N | N |
| vg0400640863 | G -> T | LOC_Os04g02030.1 | missense_variant ; p.Asp780Glu; MODERATE | nonsynonymous_codon ; D780Q | Average:46.764; most accessible tissue: Minghui63 flower, score: 79.848 | benign  |
-0.707 |
TOLERATED | 0.09 |
| vg0400640863 | G -> T | LOC_Os04g02030.1 | missense_variant ; p.Asp780Glu; MODERATE | nonsynonymous_codon ; D780E | Average:46.764; most accessible tissue: Minghui63 flower, score: 79.848 | benign |
-1.213 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400640863 | NA | 1.29E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 1.11E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 1.55E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 3.43E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | 3.10E-06 | NA | mr1478_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 5.37E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 2.21E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 2.53E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 3.56E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400640863 | NA | 3.04E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |