| Variant ID: vg0400611332 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 611332 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTCTAACATTGGTCGTTCATAGCTGCTCTACTACCTGCTATATGATATGGAACATCTTGCTGACAATCAATCTTTCCAACATTGGTCATTCATAGCTTC[C/T]
TCTAGTTGTTATATGGTATGGAAATAAAATTCAGAGGCATGAAGTTTGCAGTACAGCATACCTTCAATGTTTGTGTCAATTAACTCGTGGATGATCATTA
TAATGATCATCCACGAGTTAATTGACACAAACATTGAAGGTATGCTGTACTGCAAACTTCATGCCTCTGAATTTTATTTCCATACCATATAACAACTAGA[G/A]
GAAGCTATGAATGACCAATGTTGGAAAGATTGATTGTCAGCAAGATGTTCCATATCATATAGCAGGTAGTAGAGCAGCTATGAACGACCAATGTTAGAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.20% | 0.25% | 0.47% | NA |
| All Indica | 2759 | 95.50% | 3.70% | 0.25% | 0.58% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 0.00% | 1.86% | 2.23% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 90.80% | 7.20% | 0.55% | 1.42% | NA |
| Indica Intermediate | 786 | 97.30% | 2.20% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0400611332 | C -> DEL | N | N | silent_mutation | Average:62.816; most accessible tissue: Zhenshan97 flower, score: 79.53 | N | N | N | N |
| vg0400611332 | C -> T | LOC_Os04g01970.1 | downstream_gene_variant ; 2453.0bp to feature; MODIFIER | silent_mutation | Average:62.816; most accessible tissue: Zhenshan97 flower, score: 79.53 | N | N | N | N |
| vg0400611332 | C -> T | LOC_Os04g01990.1 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:62.816; most accessible tissue: Zhenshan97 flower, score: 79.53 | N | N | N | N |
| vg0400611332 | C -> T | LOC_Os04g01980.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.816; most accessible tissue: Zhenshan97 flower, score: 79.53 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0400611332 | NA | 2.71E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 2.89E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 7.55E-07 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 1.73E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 1.61E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 7.99E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 7.76E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 6.52E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 2.02E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0400611332 | NA | 3.38E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/